Protein expression and gene editing in monocots using foxtail mosaic virus vectors.

Protein expression and gene editing in monocots using foxtail mosaic virus vectors.

Plant viruses will be engineered to hold sequences that direct silencing of goal host genes, expression of heterologous proteins, or modifying of host genes. A set of foxtail mosaic virus (FoMV) vectors was developed that can be utilized for transient gene expression and single information RNA supply for Cas9-mediated gene modifying in maize, Setaria viridis, and Nicotiana benthamiana.

This was achieved by duplicating the FoMV capsid protein subgenomic promoter, abolishing the pointless open studying body 5A, and inserting a cloning website containing distinctive restriction endonuclease cleavage websites instantly after the duplicated promoter. The modified FoMV vectors transiently expressed inexperienced fluorescent protein (GFP) and bialaphos resistance (BAR) protein in leaves of systemically contaminated maize seedlings. GFP was detected in epidermal and mesophyll cells by epifluorescence microscopy, and expression was confirmed by Western blot analyses. Crops contaminated with FoMV carrying the bar gene had been briefly shielded from a glufosinate herbicide, and expression was confirmed utilizing a speedy antibody-based BAR strip take a look at. Expression of those proteins was stabilized by nucleotide substitutions within the sequence of the duplicated promoter area.

Single information RNAs expressed from the duplicated promoter mediated edits within the N. benthamiana Phytoene desaturase gene, the S. viridis Carbonic anhydrase 2 gene, and the maize HKT1 gene encoding a potassium transporter. The effectivity of modifying was enhanced within the presence of synergistic viruses and a viral silencing suppressor. This work expands the utility of FoMV for virus-induced gene silencing (VIGS), virus-mediated overexpression (VOX), and virus-enabled gene modifying (VEdGE) in monocots.

 

A brand new toolkit for gene tagging in Candida albicans containing recyclable markers.

 

Gene manipulation and epitope tagging are important instruments for understanding the molecular perform of particular genes. The opportunistic human pathogen Candida albicans is a diploid fungus that makes use of a non-canonical genetic code. Since choice markers out there on this organism are scarce, a number of instruments primarily based on recyclable markers have been developed for gene disruption, such because the Clox system.

 

This technique depends on the Cre recombinase, which recycles choice markers flanked by loxP websites with excessive effectivity, facilitating single marker or multi-marker recycling. Nevertheless, PCR-based modules for epitope tagging, such the pFA-modules, primarily use restricted non-recyclable auxotrophic markers. To unravel this downside, now we have used a Gibson meeting technique to assemble a set of recent plasmids the place the auxotrophic markers of the pFA vectors had been swapped with 5 recyclable marker modules of the Clox system, enhancing the flexibility of the pFA plasmids. This new toolkit, named pFA-Clox, consists of 36 new vectors for gene disruption and epitope tagging (GFP, 3xGFP, mCherry, 3xHA, 5xmyc and TAP). These plasmids include the dominant NAT1 marker, in addition to URA3, HIS1 and ARG4 cassettes, thereby allowing useful evaluation of laboratory strains in addition to scientific isolates of C. albicans. In abstract, now we have tailored the Clox system to the pFA-backbone vectors.

 

Thus, the set of primers used for the amplification of beforehand printed pFA modules may also be utilized on this new pFA-Clox system. Subsequently, this new toolkit harbors some great benefits of each techniques, permitting accelerated gene modification methods that might cut back time and prices in pressure building for C. albicans. Antitumor immunotherapeutic methods characterize an particularly promising set of approaches with speedy translational potential contemplating the dismal scientific context of high-grade gliomas. Dendritic cells (DCs) are the physique’s {most professional} antigen-presenting cells, capable of recruit and activate T cells to stimulate an adaptive immune response. On this regard, particular loading of tumor-specific antigen onto dendritic cells doubtlessly represents one of the vital superior methods to attain efficient antitumor immunization.

Protein expression and gene editing in monocots using foxtail mosaic virus vectors.

Protein expression and gene editing in monocots using foxtail mosaic virus vectors.

Chlamydia trachomatis and Chlamydia muridarum spectinomycin resistant vectors and a transcriptional fluorescent reporter to observe conversion from replicative to infectious micro organism.

Chlamydia trachomatis infections are the main reason behind sexually transmitted infections of bacterial origin. Decrease genital tract infections are sometimes asymptomatic, and due to this fact left untreated, resulting in ascending infections which have long-term penalties on feminine reproductive well being. Human pathology will be recapitulated in mice with the mouse tailored pressure C. muridarum. Eight years into the post-genetic period, important advances to develop the Chlamydia genetic toolbox have been made to facilitate the research of this essential human pathogen. Nevertheless, the necessity for extra instruments stays, particularly for C. muridarum. Right here, we describe a brand new set of spectinomycin resistant E. coli-Chlamydia shuttle vectors, for C. trachomatis and C. muridarum.
These versatile vectors permit for expression and localization research of Chlamydia effectors, akin to Inc proteins, and shall be instrumental for mutant complementation research. As well as, now we have exploited the differential expression of particular Chlamydia genes throughout the developmental cycle to engineer an omcA::gfp fluorescent transcriptional reporter. This novel device permits for monitoring RB to EB conversion on the bacterial stage. Spatiotemporal monitoring of GFP expression inside particular person inclusions revealed that RB to EB conversion initiates in micro organism positioned on the fringe of the inclusion and correlates with the time submit initiation of bacterial replication and inclusion measurement.

pUCM-T Cloning Vector Kit

BS435 20Preps
EUR 93.5
  • Product category: Molecular Biology Kits/Cloning/Cloning Kits (Specific)

pUCM-T Cloning Vector Kit

BS436 100preps
EUR 224
  • Product category: Molecular Biology Kits/Cloning/Cloning Kits (Specific)

gRNA- Cloning

PVT10957 2 ug
EUR 301

pcDNA3 GFP LIC cloning vector (6D)

PVT10748 2 ug
EUR 301

PUCM-T Cloning Vector (50ng/ul)

BS433 1UG
EUR 76.1
  • Product category: PCR Related/Vectors/Plasmids

PUCM-T Cloning Vector (50ng/ul)

BS434 5UG
EUR 154.4
  • Product category: PCR Related/Vectors/Plasmids

pCDF1-MCS1 cDNA Cloning and Expression Vector

CD100A-1 10 ug
EUR 544
  • Category: Lentiviral Technology

PALMD cloning plasmid

CSB-CL017416HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1656
  • Sequence: atggaagaagctgagctggtgaagggaagactccaggccatcacagataaaagaaaaatacaggaagaaatctcacagaagcgtctgaaaatagaggaagacaaactaaagcaccagcatttgaagaaaaaggccttgagggagaaatggcttctagatggaatcagcagcggaa
  • Show more
Description: A cloning plasmid for the PALMD gene.

PAM cloning plasmid

CSB-CL017417HU-10ug 10ug
EUR 838
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2601
  • Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat
  • Show more
Description: A cloning plasmid for the PAM gene.

PANK1 cloning plasmid

CSB-CL017421HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atggcagctaaaggcgacagcaccaatgttgataaactggtgaaggacatttacggaggagactatgaacgatttggccttcaaggatctgctgtagcatcaagctttggcaacatgatgagtaaagaaaagcgagattccatcagcaaggaagacctcgcccgggccacattggt
  • Show more
Description: A cloning plasmid for the PANK1 gene.

PAPLN cloning plasmid

CSB-CL017431HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 390
  • Sequence: atgcggctgctcctgctcgtgccgctgctgctggctccagcgcccgggtcctcggctcccaaggtgaggcggcagagtgacacctggggaccctggagccagtggagcccctgcagccggacctgtggagggggtgtcagcttccgggagcgcccctgctactcccagaggagaga
  • Show more
Description: A cloning plasmid for the PAPLN gene.

PAPOLA cloning plasmid

CSB-CL017432HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgccgtttccagttacaacacagggatcacaacaaacacaaccgccacagaagcactatggcattacttctcctatcagcttagcagcccccaaggagactgactgcgtacttacacagaaactaattgagacattgaaaccctttggggtttttgaagaggaagaggaactgca
  • Show more
Description: A cloning plasmid for the PAPOLA gene.

PARK2 cloning plasmid

CSB-CL017451HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atgatagtgtttgtcaggttcaactccagccatggtttcccagtggaggtcgattctgacaccagcatcttccagctcaaggaggtggttgctaagcgacagggggttccggctgaccagttgcgtgtgattttcgcagggaaggagctgaggaatgactggactgtgcagaatt
  • Show more
Description: A cloning plasmid for the PARK2 gene.

PARN cloning plasmid

CSB-CL017456HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1920
  • Sequence: atggagataatcaggagcaattttaagagtaatcttcacaaagtgtaccaggccatagaggaggccgacttcttcgccatcgatggggagttttcaggaatcagtgatggaccttcagtctctgcattaacaaatggttttgacactccagaagagaggtatcagaagcttaaaa
  • Show more
Description: A cloning plasmid for the PARN gene.

PAX3 cloning plasmid

CSB-CL017489HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagat
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX3 cloning plasmid

CSB-CL017489HU2-10ug 10ug
EUR 517
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGCGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX4 cloning plasmid

CSB-CL017490HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: ATGGCCTGGTCCAGTAAGTCTTGGCTTTGTCTTATAGCCTCCTCCTGTCCCAGGGACACTCTCCTTCCTTCTGCCCATCATGCCTCACCTGTCCCTGCTTCTCACCTGACTCAGGTATCTAATGGCTGTGTGAGCAAGATCCTAGGGCGTTACTACCGCACAGGTGTCTTGGAGCC
  • Show more
Description: A cloning plasmid for the PAX4 gene.

PAX6 cloning plasmid

CSB-CL017492HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1267
  • Sequence: atgcagaacagtcacagcggagtgaatcagctcggtggtgtctttgtcaacgggcggccactgccggactccacccggcagaagattgtagagctagctcacagcggggcccggccgtgcgacatttcccgaattctgcaggtgtccaacggatgtgtgagtaaaattctgggca
  • Show more
Description: A cloning plasmid for the PAX6 gene.

PAX7 cloning plasmid

CSB-CL017493HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: ATGGCGGCCCTTCCCGGCACGGTACCGAGAATGATGCGGCCGGCTCCGGGGCAGAACTACCCCCGCACGGGATTCCCTTTGGAAGTGTCCACCCCGCTTGGCCAAGGCCGGGTCAATCAGCTGGGAGGGGTCTTCATCAATGGGCGACCCCTGCCTAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX7 gene.

PAX8 cloning plasmid

CSB-CL017494HU-10ug 10ug
EUR 489
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1353
  • Sequence: atgcctcacaactccatcagatctggccatggagggctgaaccagctgggaggggcctttgtgaatggcagacctctgccggaagtggtccgccagcgcatcgtagacctggcccaccagggtgtaaggccctgcgacatctctcgccagctccgcgtcagccatggctgcgtca
  • Show more
Description: A cloning plasmid for the PAX8 gene.

PBLD cloning plasmid

CSB-CL017501HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 867
  • Sequence: atgaagcttcctattttcatagcagatgcattcacagcaagagcatttcgtgggaatcctgctgctgtttgcctcctagaaaatgaattggatgaagacatgcatcagaaaattgcaagggagatgaacctctctgaaactgcttttatccgaaaactgcacccgacagacaactt
  • Show more
Description: A cloning plasmid for the PBLD gene.

PBX2 cloning plasmid

CSB-CL017506HU1-10ug 10ug
EUR 404
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.

PBX2 cloning plasmid

CSB-CL017506HU2-10ug 10ug
EUR 472
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.

PBX3 cloning plasmid

CSB-CL017507HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 825
  • Sequence: atgaaccttctccgagaacagagtagaacacgtcccatttctccaaaagagattgaaagaatggtgggcatcatccatcgaaaatttagttccattcagatgcagctcaaacaaagcacttgtgaagcagttatgattttaagatcaaggttccttgatgccagacggaaaaggcg
  • Show more
Description: A cloning plasmid for the PBX3 gene.

PC cloning plasmid

CSB-CL017511HU-10ug 10ug
EUR 1252
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3537
  • Sequence: atgctgaagttccgaacagtccatgggggcctgaggctcctgggaatccgccgaacctccaccgcccccgctgcctccccaaatgtccggcgcctggagtataagcccatcaagaaagtcatggtggccaacagaggtgagattgccatccgtgtgttccgggcctgcacggagc
  • Show more
Description: A cloning plasmid for the PC gene.

PCBD1 cloning plasmid

CSB-CL017514HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atggctggcaaagcacacaggctgagcgctgaggagagggaccagctgctgccaaacctgagggctgtggggtggaatgagctggaaggccgtgatgccatcttcaagcagtttcatttcaaagacttcaacagggcctttgggttcatgacaagagtggccctgcaggctgagaa
  • Show more
Description: A cloning plasmid for the PCBD1 gene.

PCBP4 cloning plasmid

CSB-CL017521HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgagcggctcggacgggggactggaggaggagccagagctcagcatcaccctcacgctgcggatgctgatgcacgggaaggaagtgggcagcatcatcgggaagaagggcgagactgtaaagcgaatccgggagcagagcagtgcccggatcaccatctccgagggctcctgcc
  • Show more
Description: A cloning plasmid for the PCBP4 gene.

PCCB cloning plasmid

CSB-CL017523HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1620
  • Sequence: atggcggcggcattacgggtggcggcggtcggggcaaggctcagcgttctggcgagcggtctccgcgccgcggtccgcagcctttgcagccaggccacctctgttaacgaacgcatcgaaaacaagcgccggaccgcgctgctgggagggggccaacgccgtattgacgcgcagc
  • Show more
Description: A cloning plasmid for the PCCB gene.

PCDH8 cloning plasmid

CSB-CL017537HU-10ug 10ug
EUR 1147
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3213
  • Sequence: atgagtcctgtgaggcgttggggcagcccctgccttttccccttgcagctcttcagcctctgctgggtgctctcagtggcccagagcaaaacagtccgatacagcaccttcgaggaggatgcccccggcacggtcatcgggaccctggccgaggacctgcacatgaaagtatcgg
  • Show more
Description: A cloning plasmid for the PCDH8 gene.

PCF11 cloning plasmid

CSB-CL017603HU-10ug 10ug
EUR 1819
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4668
  • Sequence: ATGTCAGAGCAGACGCCGGCCGAGGCCGGTGCTGCGGGGGCCCGGGAGGACGCCTGTCGGGATTATCAGTCATCGCTCGAAGACCTGACCTTCAATAGCAAGCCGCACATCAATATGCTGACCATTCTAGCCGAGGAGAACCTGCCCTTCGCCAAGGAGATCGTCTCTCTCATCG
  • Show more
Description: A cloning plasmid for the PCF11 gene.

PCGF2 cloning plasmid

CSB-CL017606HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atgcatcggactacacggatcaaaatcacagagctgaacccccacctcatgtgtgccctctgcggggggtacttcatcgacgccaccactatcgtggagtgcctgcattccttctgcaaaacctgcatcgtgcgctacctggagaccaacaaatactgccccatgtgtgacgtgc
  • Show more
Description: A cloning plasmid for the PCGF2 gene.

PCMT1 cloning plasmid

CSB-CL017618HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atggcctggaaatccggcggcgccagccactcggagctaatccacaatctccgcaaaaatggaatcatcaagacagataaagtatttgaagtgatgctggctacagaccgctcccactatgcaaaatgtaacccatacatggattctccacaatcaataggtttccaagcaacaat
  • Show more
Description: A cloning plasmid for the PCMT1 gene.

PCNA cloning plasmid

CSB-CL017621HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 786
  • Sequence: atgttcgaggcgcgcctggtccagggctccatcctcaagaaggtgttggaggcactcaaggacctcatcaacgaggcctgctgggatattagctccagcggtgtaaacctgcagagcatggactcgtcccacgtctctttggtgcagctcaccctgcggtctgagggcttcgacac
  • Show more
Description: A cloning plasmid for the PCNA gene.

PCNXL2 cloning plasmid

CSB-CL017629HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 915
  • Sequence: atgctgttttttggtggttctgctgtgtctgggataacctcggctgtttacagtgtggcccggagcgtcttggctgccgccctgctccacgcagtctgcttcagtgcagtgaaggaaccgtggagcatgcaacacatcccggcactgttttcggccttctgtggcctcttggtcgc
  • Show more
Description: A cloning plasmid for the PCNXL2 gene.

PCOLCE2 cloning plasmid

CSB-CL017632HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 831
  • Sequence: atgaggggcgcgaacgcctgggcgccactctgcctgctgctggctgccgccacccagctctcgcggcagcagtccccagagagacctgttttcacatgtggtggcattcttactggagagtctggatttattggcagtgaaggttttcctggagtgtaccctccaaatagcaaatg
  • Show more
Description: A cloning plasmid for the PCOLCE2 gene.

PCP4 cloning plasmid

CSB-CL017636HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 189
  • Sequence: atgagtgagcgacaaggtgctggggcaaccaatggaaaagacaagacatctggtgaaaatgatggacagaagaaagttcaagaagaatttgacattgacatggatgcaccagagacagaacgtgcagcggtggccattcagtctcagttcagaaaattccagaagaagaaggctgg
  • Show more
Description: A cloning plasmid for the PCP4 gene.

PCSK1 cloning plasmid

CSB-CL017640HU-10ug 10ug
EUR 742
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2262
  • Sequence: atggagcgaagagcctggagtctgcagtgcactgctttcgtcctcttttgcgcttggtgtgcactgaacagtgcaaaagcgaaaaggcaatttgtcaatgaatgggcagcggagatccccgggggcccggaagcagcctcggccatcgccgaggagctgggctatgaccttttgg
  • Show more
Description: A cloning plasmid for the PCSK1 gene.

PCSK4 cloning plasmid

CSB-CL017643HU-10ug 10ug
EUR 314
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atgggcacgcgctccacactcgtggccatacgacccttggacgtcagcactgaaggctacaacaactgggtcttcatgtccacccacttctgggatgagaacccacagggcgtgtggaccctgggcctagagaacaagggctactatttcaacacggggacgttgtaccgctacac
  • Show more
Description: A cloning plasmid for the PCSK4 gene.

PCSK5 cloning plasmid

CSB-CL017644HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2742
  • Sequence: atgggctgggggagccgctgctgctgcccgggacgtttggacctgctgtgcgtgctggcgctgctcgggggctgcctgctccccgtgtgtcggacgcgcgtctacaccaaccactgggcagtcaaaatcgccgggggcttcccggaggccaaccgtatcgccagcaagtacggat
  • Show more
Description: A cloning plasmid for the PCSK5 gene.

PCSK7 cloning plasmid

CSB-CL017646HU-10ug 10ug
EUR 607
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atgccgaaggggaggcagaaagtgccacacttggatgcccccctgggcctgcccacctgcctctggctggaattagccgggctcttcttactggttccctgggtcatgggcctggcagggacaggtgggcctgatggccagggcacaggggggccgagctgggctgtgcacctgg
  • Show more
Description: A cloning plasmid for the PCSK7 gene.

PCTP cloning plasmid

CSB-CL017651HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atggagctggccgccggaagcttctcggaggagcagttctgggaggcctgcgccgagctccagcagcccgctctggccggggccgactggcagctcctagtggagacctcgggcatcagcatctaccggctgctggacaagaagactggactttatgagtataaagtctttggtgt
  • Show more
Description: A cloning plasmid for the PCTP gene.

PCYOX1 cloning plasmid

CSB-CL017652HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga
  • Show more
Description: A cloning plasmid for the PCYOX1 gene.

PDCD1LG2 cloning plasmid

CSB-CL017667HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgatcttcctcctgctaatgttgagcctggaattgcagcttcaccagatagcagctttattcacagtgacagtccctaaggaactgtacataatagagcatggcagcaatgtgaccctggaatgcaactttgacactggaagtcatgtgaaccttggagcaataacagccagttt
  • Show more
Description: A cloning plasmid for the PDCD1LG2 gene.

PDCD5 cloning plasmid

CSB-CL017671HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaactt
  • Show more
Description: A cloning plasmid for the PDCD5 gene.

PDCD6 cloning plasmid

CSB-CL017672HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: atggccgcctactcttaccgccccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactccctttaatccagt
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDCD6 cloning plasmid

CSB-CL017672HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: atggccgcctactcttaccgccccggccctggggccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactcc
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDCD6 cloning plasmid

CSB-CL017672HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: ATGGCCGCCTACTCTTACCGCCCCGGCCCTGGGGCCGGCCCTGGGCCTGCTGCAGGCGCGGCGCTGCCGGACCAGAGCTTCCTGTGGAACGTTTTCCAGAGGGTCGATAAAGACAGGAGTGGAGTGATATCAGACACCGAGCTTCAGCAAGCTCTCTCCAACGGCACGTGGACTCC
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDGFB cloning plasmid

CSB-CL017709HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgaatcgctgctgggcgctcttcctgtctctctgctgctacctgcgtctggtcagcgccgagggggaccccattcccgaggagctttatgagatgctgagtgaccactcgatccgctcctttgatgatctccaacgcctgctgcacggagaccccggagaggaagatggggccga
  • Show more
Description: A cloning plasmid for the PDGFB gene.

PDGFRA cloning plasmid

CSB-CL017712HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atggggacttcccatccggcgttcctggtcttaggctgtcttctcacagggctgagcctaatcctctgccagctttcattaccctctatccttccaaatgaaaatgaaaaggttgtgcagctgaattcatccttttctctgagatgctttggggagagtgaagtgagctggcagta
  • Show more
Description: A cloning plasmid for the PDGFRA gene.

PDGFRB cloning plasmid

CSB-CL017713HU-10ug 10ug
EUR 1217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3321
  • Sequence: atgcggcttccgggtgcgatgccagctctggccctcaaaggcgagctgctgttgctgtctctcctgttacttctggaaccacagatctctcagggcctggtcgtcacacccccggggccagagcttgtcctcaatgtctccagcaccttcgttctgacctgctcgggttcagctc
  • Show more
Description: A cloning plasmid for the PDGFRB gene.

PDHA1 cloning plasmid

CSB-CL017715HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgaggaagatgctcgccgccgtctcccgcgtgctgtctggcgcttctcagaagccggcaagcagagtgctggtagcatcccgtaattttgcaaatgatgctacatttgaaattaagaaatgtgaccttcaccggctggaagaaggccctcctgtcacaacagtgctcaccaggg
  • Show more
Description: A cloning plasmid for the PDHA1 gene.

PDHA2 cloning plasmid

CSB-CL017716HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: ATGCTGGCCGCCTTCATCTCCCGCGTGTTGAGGCGAGTTGCCCAGAAATCAGCTCGCAGAGTGCTGGTGGCATCCCGTAACTCCTCAAATGACGCTACATTTGAAATTAAGAAATGTGATCTTTATCTGTTGGAAGAGGGTCCCCCTGTCACTACAGTGCTCACTAGGGCGGAGG
  • Show more
Description: A cloning plasmid for the PDHA2 gene.

PDHA2 cloning plasmid

CSB-CL017716HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: ATGCTGGCCGCCTTCATCTCCCGCGTGTTGAGGCGAGTTGCCCAGAAATCAGCTCGCAGAGTGCTGGTGGCATCCCGTAACTCCTCAAATGACGCTACATTTGAAATTAAGAAATGTGATCTTTATCTGTTGGAAGAGGGTCCCCCTGTCACTACAGTGCTCACTAGGGCGGAGG
  • Show more
Description: A cloning plasmid for the PDHA2 gene.

PDHB cloning plasmid

CSB-CL017717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atggcggcggtgtctggcttggtgcggagaccccttcgggaggtctccgggctgctgaagaggcgctttcactggaccgcgccggctgcgctgcaggtgacagttcgtgatgctataaatcagggtatggatgaggagctggaaagagatgagaaggtatttctgcttggagaag
  • Show more
Description: A cloning plasmid for the PDHB gene.

PDHX cloning plasmid

CSB-CL017718HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggcggcctcctggaggctgggctgtgatccgcggctgctgcgttatcttgtgggcttccctggccgccgaagcgtagggctggtgaagggggctcttgggtggtctgtaagccgcggagctaattggagatggtttcacagcacgcagtggcttcggggtgatcccattaaga
  • Show more
Description: A cloning plasmid for the PDHX gene.

PDIA3 cloning plasmid

CSB-CL017720HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgcgcctccgccgcctagcgctgttcccgggtgtggcgctgcttcttgccgcggcccgcctcgccgctgcctccgacgtgctagaactcacggacgacaacttcgagagtcgcatctccgacacgggctctgcgggcctcatgctcgtcgagttcttcgccccctggtgtggac
  • Show more
Description: A cloning plasmid for the PDIA3 gene.

PDIA3 cloning plasmid

CSB-CL017720HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgcgcctccgccgcctagcgctgttcccgggtgtggcgctgcttcttgccgcggcccgcctcgccgctgcctccgacgtgctagaactcacggacgacaacttcgagagtcgcatctccgacacgggctctgcgggcctcatgctcgtcgagttcttcgctccctggtgtggac
  • Show more
Description: A cloning plasmid for the PDIA3 gene.

PDIA4 cloning plasmid

CSB-CL017722HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1938
  • Sequence: atgaggccccggaaagccttcctgctcctgctgctcttggggctggtgcagctgctggccgtggcgggtgccgagggcccggacgaggattcttctaacagagaaaatgccattgaggatgaagaggaggaggaggaggaagatgatgatgaggaagaagacgacttggaagtta
  • Show more
Description: A cloning plasmid for the PDIA4 gene.

PDLIM1 cloning plasmid

CSB-CL017731HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atgaccacccagcagatagacctccagggcccggggccgtggggcttccgcctcgtgggcggcaaggacttcgagcagcctctcgccatttcccgggtcactcctggaagcaaggcggctctagctaatttatgtattggagatgtaatcacagccattgatggggaaaatactag
  • Show more
Description: A cloning plasmid for the PDLIM1 gene.

PDLIM4 cloning plasmid

CSB-CL017735HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 993
  • Sequence: atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagct
  • Show more
Description: A cloning plasmid for the PDLIM4 gene.

PDLIM4 cloning plasmid

CSB-CL017735HU2-10ug 10ug
EUR 317
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagct
  • Show more
Description: A cloning plasmid for the PDLIM4 gene.

PDPK1 cloning plasmid

CSB-CL017738HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atggccaggaccaccagccagctgtatgacgccgtgcccatccagtccagcgtggtgttatgttcctgcccatccccatcaatggtgaggacccagactgagtccagcacgccccctggcattcctggtggcagcaggcagggccccgccatggacggcactgcagccgagcctc
  • Show more
Description: A cloning plasmid for the PDPK1 gene.

PDPN cloning plasmid

CSB-CL017739HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 489
  • Sequence: atgtggaaggtgtcagctctgctcttcgttttgggaagcgcgtcgctctgggtcctggcagaaggagccagcacaggccagccagaagatgacactgagactacaggtttggaaggcggcgttgccatgccaggtgccgaagatgatgtggtgactccaggaaccagcgaagaccg
  • Show more
Description: A cloning plasmid for the PDPN gene.

PDXK cloning plasmid

CSB-CL017748HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atggaggaggagtgccgggtgctctccatacagagccacgtcatccgcggctacgtgggcaaccgggcggccacgttcccgctgcaggttttgggatttgagattgacgcggtgaactctgtccagttttcaaaccacacaggctatgcccactggaagggccaagtgctgaattc
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDXK cloning plasmid

CSB-CL017748HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atgtccccttccatctctgacccttgcctgggacaagctttgatggggggccccagcttcaaggctgtggtgggaacagcacccccaaatgccagcctctcctttcttcccatccaccagtatactgcggggccatttctggtctttgtccaacaggaaacccatttctggtggga
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDYN cloning plasmid

CSB-CL017750HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatg
  • Show more
Description: A cloning plasmid for the PDYN gene.

PEBP1 cloning plasmid

CSB-CL017766HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 564
  • Sequence: atgccggtggacctcagcaagtggtccgggcccttgagcctgcaagaagtggacgagcagccgcagcacccactgcatgtcacctacgccggggcggcggtggacgagctgggcaaagtgctgacgcccacccaggttaagaatagacccaccagcatttcgtgggatggtcttga
  • Show more
Description: A cloning plasmid for the PEBP1 gene.

PECR cloning plasmid

CSB-CL017769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atggcctcctgggctaagggcaggagctacctggcgcctggtttgctgcagggccaagtggccatcgtcaccggcggggccacgggcatcggaaaagccatcgtgaaggagctcctggagctggggagtaatgtggtcattgcatcccgtaagttggagagattgaagtctgcggc
  • Show more
Description: A cloning plasmid for the PECR gene.

PEMT cloning plasmid

CSB-CL017780HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atgaagagatctgggaacccgggagccgaggtaacgaacagctcggtggcagggcctgactgctgcggaggcctcggcaatattgattttagacaggcagacttctgcgttatgacccggctgctgggctacgtggaccccctggatcccagctttgtggctgccgtcatcaccat
  • Show more
Description: A cloning plasmid for the PEMT gene.

PEMT cloning plasmid

CSB-CL017780HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atgaagagatctgggaacccgggagccgaggtaacgaacagctcggtggcagggcctgactgctgcggaggcctcggcaatattgattttagacaggcagacttctgcgttatgacccggctgctgggctacgtggaccccctggatcccagctttgtggctgctgtcatcaccat
  • Show more
Description: A cloning plasmid for the PEMT gene.

PENK cloning plasmid

CSB-CL017781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 804
  • Sequence: atggcgcggttcctgacactttgcacttggctgctgttgctcggccccgggctcctggcgaccgtgcgggccgaatgcagccaggattgcgcgacgtgcagctaccgcctagtgcgcccggccgacatcaacttcctggcttgcgtaatggaatgtgaaggtaaactgccttctct
  • Show more
Description: A cloning plasmid for the PENK gene.

PEPD cloning plasmid

CSB-CL017784HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.

PEPD cloning plasmid

CSB-CL017784HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.

PER1 cloning plasmid

CSB-CL017786HU1-10ug 10ug
EUR 591
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atgagtggccccctagaaggggctgatgggggaggggaccccaggcctggggaatcattttgtcctgggggcgtcccatcccctgggcccccacagcaccggccttgcccaggccccagcctggccgatgacaccgatgccaacagcaatggttcaagtggcaatgagtccaacg
  • Show more
Description: A cloning plasmid for the PER1 gene.

PER1 cloning plasmid

CSB-CL017786HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 885
  • Sequence: atgagtggccccctagaaggggctgatgggggaggggaccccaggcctggggaatcattttgtcctgggggcgtcccatcccctgggcccccacagcaccggccttgcccaggccccagcctggccgatgacaccgatgccaacagcaatggttcaagtggcaatgagtccaacgg
  • Show more
Description: A cloning plasmid for the PER1 gene.

PER3 cloning plasmid

CSB-CL017788HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1137
  • Sequence: atgccccgcggggaagctcctggccccgggagacggggggctaaggacgaggccctgggcgaagaatcgggggagcggtggagccccgagttccatctgcagaggaaattggcggacagcagccacagtgaacagcaagatcgaaacagagtttctgaagaacttatcatggttg
  • Show more
Description: A cloning plasmid for the PER3 gene.

PES1 cloning plasmid

CSB-CL017791HU-10ug 10ug
EUR 604
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1767
  • Sequence: atgggaggccttgagaagaagaagtatgaacgaggctcggccaccaactacatcacccggaacaaagcccggaagaagctccagctgagcttggctgactttaggcggctgtgcattctgaagggcatttatccccatgaacccaaacacaagaagaaggttaacaagggttcta
  • Show more
Description: A cloning plasmid for the PES1 gene.

PEX10 cloning plasmid

CSB-CL017794HU1-10ug 10ug
EUR 384
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttgg
  • Show more
Description: A cloning plasmid for the PEX10 gene.

PEX10 cloning plasmid

CSB-CL017794HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttg
  • Show more
Description: A cloning plasmid for the PEX10 gene.

PEX11A cloning plasmid

CSB-CL017795HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggacgccttcacccgcttcaccaaccagacccagggccgggaccgactcttcagagccactcagtacacatgcatgttgcttagatatttgttagagcccaaagctggcaaagagaaggtggtaatgaagctcaagaaactggagtccagtgtgagcactggtcgtaaatggtt
  • Show more
Description: A cloning plasmid for the PEX11A gene.

PEX11A cloning plasmid

CSB-CL017795HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGAAGTCCGCGCTTTTCACCCGCTTCACCAACCAGACCCAGGGCCGGGACCGACTCTTCAGAGCCACTCAGTACACATGCATGTTGCTTAGATATTTGTTAGAGCCCAAAGCTGGCAAAGAGAAGGTGGTAATGAAGCTCAAGAAACTGGAGTCCAGTGTGAGCACTGGTCGTAA
  • Show more
Description: A cloning plasmid for the PEX11A gene.

PEX11B cloning plasmid

CSB-CL017796HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 780
  • Sequence: atggacgcctgggtccgcttcagtgctcagagccaagcccgggagcggctgtgtagggccgcccagtatgcttgctctcttcttggccatgcgctgcagaggcatggagccagtcctgagttacagaaacagattcgacaactggagagccacctgagccttggaagaaagcttct
  • Show more
Description: A cloning plasmid for the PEX11B gene.

PEX14 cloning plasmid

CSB-CL017800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atggcgtcctcggagcaggcagagcagccgagccagccaagctctactccaggaagtgaaaatgtgctgcctcgagagccgctgattgccacggcagtgaagtttctacagaattcccgggtccgccagagcccacttgcaaccaggagagcattcctaaagaagaaagggctga
  • Show more
Description: A cloning plasmid for the PEX14 gene.

PEX19 cloning plasmid

CSB-CL017802HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 900
  • Sequence: atggccgccgctgaggaaggctgtagtgtcggggccgaagcggacagggaattggaggagcttctggaaagtgctcttgatgatttcgataaagccaaaccctccccagcacccccttctaccaccacggcccctgatgcttcggggccccagaagagatcgccaggagacactgc
  • Show more
Description: A cloning plasmid for the PEX19 gene.

PEX3 cloning plasmid

CSB-CL017804HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: atgctgaggtctgtatggaattttctgaaacgccacaaaaagaaatgcatcttcctgggcacggtccttggaggagtatatattctggggaaatatggacagaagaaaatcagagaaatacaggaaagggaggctgcagaatacattgcccaagcacgacgacaatatcattttg
  • Show more
Description: A cloning plasmid for the PEX3 gene.

PEX5 cloning plasmid

CSB-CL017805HU-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1896
  • Sequence: atggcaatgcgggagctggtggaggccgaatgcgggggtgccaacccgctcatgaagctcgccgggcacttcacccaggacaaggcccttcggcaggagggattgaggcctggcccctggccccccggagccccggcctctgaggcagcctccaagcctttgggagtagcttctg
  • Show more
Description: A cloning plasmid for the PEX5 gene.

PEX7 cloning plasmid

CSB-CL017808HU1-10ug 10ug
EUR 346
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaag
  • Show more
Description: A cloning plasmid for the PEX7 gene.

PEX7 cloning plasmid

CSB-CL017808HU2-10ug 10ug
EUR 381
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaag
  • Show more
Description: A cloning plasmid for the PEX7 gene.

PF4V1 cloning plasmid

CSB-CL017810HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgagctccgcagccaggtcccgcctcacccgcgccacccgccaggagatgctgttcttggcgttgctgctcctgccagttgtggtcgccttcgccagagctgaagctgaagaagatggggacctgcagtgcctgtgtgtgaagaccacctcccaggtccgtcccaggcacatcac
  • Show more
Description: A cloning plasmid for the PF4V1 gene.

PFDN1 cloning plasmid

CSB-CL017812HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atggccgcccccgtggatctagagctgaagaaggccttcacagagcttcaagccaaagttattgacactcaacagaaggtgaagctcgcagacatacagattgaacagctaaacagaacgaaaaagcatgcacatcttacagatacagagatcatgactttggtagatgagactaa
  • Show more
Description: A cloning plasmid for the PFDN1 gene.

PFDN2 cloning plasmid

CSB-CL017813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcggagaacagcggtcgcgccggcaagagcagcgggagcggcgcggggaagggggcggtgtccgcagagcaggtgattgctggcttcaaccgccttcggcaggaacagcgaggcctggcatccaaagcagctgagttggagatggagttgaatgagcacagcctagtgatcga
  • Show more
Description: A cloning plasmid for the PFDN2 gene.

PFDN4 cloning plasmid

CSB-CL017814HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atggcggccaccatgaagaaggcggctgcagaagatgtcaatgttactttcgaagatcaacaaaagataaacaaatttgcacggaatacaagtagaatcacagagctgaaggaagaaatagaagtaaaaaagaaacaactccaaaacctagaagatgcttgtgatgacatcatgct
  • Show more
Description: A cloning plasmid for the PFDN4 gene.

PFDN5 cloning plasmid

CSB-CL017815HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcgcagtctattaacatcacggagctgaatctgccgcagctagaaatgctcaagaaccagctggaccaggaagtggagttcttgtccacgtccattgctcagctcaaagtggtacagaccaagtatgtggaagccaaggactgtctgaacgtgctgaacaagagcaacgaggg
  • Show more
Description: A cloning plasmid for the PFDN5 gene.

PFKFB1 cloning plasmid

CSB-CL017817HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1416
  • Sequence: ATGTCTCCAGAGATGGGAGAGCTCACCCAAACCAGGTTGCAGAAGATCTGGATTCCACACAGCAGCGGCAGCAGCAGGCTGCAACGGAGAAGGGGCTCATCCATACCCCAGTTTACCAATTCCCCCACAATGGTGATCATGGTGGGTTTACCAGCTCGAGGCAAGACCTATATCT
  • Show more
Description: A cloning plasmid for the PFKFB1 gene.

PFKL cloning plasmid

CSB-CL017821HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atggccgcggtggacctggagaagctgcgggcgtcgggcgcgggcaaggccatcggcgtcctgaccagcggcggcgacgcgcaaggcatgaacgctgctgtccgggctgtgacgcgcatgggcatttatgtgggtgccaaagtcttcctcatctacgagggctatgagggcctcg
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atggccgcggtggacctggagaagctgcgggcgtcgggcgcgggcaaggccatcggcgtcctgaccagcggcggcgacgcgcaaggcatgaacgctgctgtccgggctgtgacgcgcatgggcatttatgtgggtgccaaagtcttcctcatctacgagggctatgagggcctcg
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU3-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2484
  • Sequence: atgtgtaaccagggtagaggtcgagagtcctctcgtgggggtctccatgttcaagggagctgccgaggcttgagcaggagcccccagcaggaaactggctttgccaaggcccccgctgggacagactgtttctttcactgcagtcctgggagccgagggcaaggggacaggaaag
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU4-10ug 10ug
EUR 502
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atgggcatggaggcggtgatggcgctgctggaagccacgcctgacacgccggcctgcgtggtcaccctctcggggaaccagtcagtgcggctgcccctcatggagtgcgtgcagatgaccaaggaagtgcagaaagccatggatgacaagaggtttgacgaggccacccagctcc
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKM cloning plasmid

CSB-CL017822HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atgacccatgaagagcaccatgcagccaaaaccctggggattggcaaagccattgctgtcttaacctctggtggagatgcccaaggtatgaatgctgctgtcagggctgtggttcgagttggtatcttcaccggtgcccgtgtcttctttgtccatgagggttatcaaggcctgg
  • Show more
Description: A cloning plasmid for the PFKM gene.

PFKM cloning plasmid

CSB-CL017822HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atgacccatgaagagcaccatgcagccaaaaccctggggattggcaaagccattgctgtcttaacctctggtggagatgcccaaggtatgaatgctgctgtcagggctgtggttcgagttggtatcttcaccggtgcccgtgtcttctttgtccatgagggttatcaaggcctgg
  • Show more
Description: A cloning plasmid for the PFKM gene.

PFN1 cloning plasmid

CSB-CL017824HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggccgggtggaacgcctacatcgacaacctcatggcggacgggacctgtcaggacgcggccatcgtgggctacaaggactcgccctccgtctgggccgccgtccccgggaaaacgttcgtcaacatcacgccagctgaggtgggtgtcctggttggcaaagaccggtcaagttt
  • Show more
Description: A cloning plasmid for the PFN1 gene.

PFN2 cloning plasmid

CSB-CL017825HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggccggttggcagagctacgtggataacctgatgtgcgatggctgctgccaggaggccgccattgtcggctactgcgacgccaaatacgtctgggcagccacggcagggggcgtctttcagagcattacgccaatagaaatagatatgattgtaggaaaagaccgggaaggttt
  • Show more
Description: A cloning plasmid for the PFN2 gene.

PGAM2 cloning plasmid

CSB-CL017835HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atggccactcaccgcctcgtgatggtccggcacggcgagagcacatggaaccaggagaaccgtttctgtggctggttcgatgcagagctgagtgaaaaggggaccgaggaggccaagcggggagccaaggccatcaaggatgccaagatggagtttgacatctgctacacgtcagt
  • Show more
Description: A cloning plasmid for the PGAM2 gene.

PGC cloning plasmid

CSB-CL017849HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgaagtggatggtggtggtcttggtctgcctccagctcttggaggcagcagtggtcaaagtgcccctgaagaaatttaagtctatccgtgagaccatgaaggagaagggcttgctgggggagttcctgaggacccacaagtatgatcctgcttggaagtaccgctttggtgacct
  • Show more
Description: A cloning plasmid for the PGC gene.

PGD cloning plasmid

CSB-CL017850HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1452
  • Sequence: atggcccaagctgacatcgcgctgatcggattggccgtcatgggccagaacttaattctgaacatgaatgaccacggctttgtggtctgtgcttttaataggactgtctccaaagttgatgatttcttggccaatgaggcaaagggaaccaaagtggtgggtgcccagtccctga
  • Show more
Description: A cloning plasmid for the PGD gene.

PGF cloning plasmid

CSB-CL017854HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atgccggtcatgaggctgttcccttgcttcctgcagctcctggccgggctggcgctgcctgctgtgcccccccagcagtgggccttgtctgctgggaacggctcgtcagaggtggaagtggtacccttccaggaagtgtggggccgcagctactgccgggcgctggagaggctggt
  • Show more
Description: A cloning plasmid for the PGF gene.

PGK1 cloning plasmid

CSB-CL017856HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtcgctttctaacaagctgacgctggacaagctggacgttaaagggaagcgggtcgttatgagagtcgacttcaatgttcctatgaagaacaaccagataacaaacaaccagaggattaaggctgctgtcccaagcatcaaattctgcttggacaatggagccaagtcggtag
  • Show more
Description: A cloning plasmid for the PGK1 gene.

PGK2 cloning plasmid

CSB-CL017859HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtctctttctaagaagttgactttagacaaactggatgttagagggaagcgagtcatcatgagagtagacttcaatgttcccatgaagaagaaccagattacaaacaaccagaggatcaaggcttccatcccaagcatcaagtactgcctggacaatggagccaaggcagtag
  • Show more
Description: A cloning plasmid for the PGK2 gene.

PGLS cloning plasmid

CSB-CL017861HU1-10ug 10ug
EUR 279
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 603
  • Sequence: atggccgcgccggccccgggcctcatctcggtgttctcgagttcccaggagctgggtgcggcgctagcgcagctggtggcccagcgcgcagcatgctgcctggcaggggcccgcgcccgtttcgcgctcggcctgtcgggcgggagcctcgtctcgatgctagcccgcgagctacc
  • Show more
Description: A cloning plasmid for the PGLS gene.

PGLS cloning plasmid

CSB-CL017861HU2-10ug 10ug
EUR 327
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 777
  • Sequence: atggccgcgccggccccgggcctcatctcggtgttctcgagttcccaggagctgggtgcggcgctagcgcagctggtggcccagcgcgcagcatgctgcctggcaggggcccgcgcccgtttcgcgctcggcttgtcgggcgggagcctcgtctcgatgctagcccgcgagctacc
  • Show more
Description: A cloning plasmid for the PGLS gene.

PGLYRP3 cloning plasmid

CSB-CL017864HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atggggacgctgccatggcttcttgccttcttcattctgggtctccaggcttgggatactcccaccatcgtctcccgcaaggagtggggggcaagaccgctcgcctgcagggccctgctgaccctgcctgtggcctacatcatcacagaccagctcccagggatgcagtgccagc
  • Show more
Description: A cloning plasmid for the PGLYRP3 gene.

PGLYRP3 cloning plasmid

CSB-CL017864HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atggggacgctgccatggcttcttgccttcttcattctgggtctccaggcttgggatactcccaccatcgtctcccgcaaggagtggggggcaagaccgctcgcctgcagggccctgctgaccctgcctgtggcctacatcatcacagaccagctcccagggatgcagtgccagc
  • Show more
Description: A cloning plasmid for the PGLYRP3 gene.

PGLYRP4 cloning plasmid

CSB-CL017865HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: ATGCTGCCGTGGCTTCTTGTCTTCTCTGCTCTGGGTCTCCAGGCCTGGGGTGATTCCTCCTGGAACAAAACACAAGCTAAACAGGTATCAGAGGGGCTCCAGTACCTATTTGAGAACATCTCCCAGCTCACTGAAAAAGGCCTTCCCACAGATGTCTCCACCACGGTCTCTCGCA
  • Show more
Description: A cloning plasmid for the PGLYRP4 gene.

PGM1 cloning plasmid

CSB-CL017866HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: atggtgaagatcgtgacagttaagacccaggcgtaccaggaccagaagccgggcacgagcgggctgcggaagcgggtgaaggtgttccagagcagcgccaactacgcggagaacttcatccagagtatcatctccaccgtggagccggcgcagcggcaggaggccacgctggtgg
  • Show more
Description: A cloning plasmid for the PGM1 gene.

PGM1 cloning plasmid

CSB-CL017866HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: ATGGTGAAGATCGTGACAGTTAAGACCCAGGCGTACCAGGACCAGAAGCCGGGCACGAGCGGGCTGCGGAAGCGGGTGAAGGTGTTCCAGAGCAGCGCCAACTACGCGGAGAACTTCATCCAGAGTATCATCTCCACCGTGGAGCCGGCGCAGCGGCAGGAGGCCACGCTGGTGG
  • Show more
Description: A cloning plasmid for the PGM1 gene.

PGM3 cloning plasmid

CSB-CL017869HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggatttaggtgctattacaaaatactcagcattacacgccaagcccaatggactgatccttcaatacgggactgctggatttcgaacgaaggcagaacatcttgatcatgtcatgtttcgcatgggattattagctgtcctgaggtcaaaacagacaaaatccactataggag
  • Show more
Description: A cloning plasmid for the PGM3 gene.

PGRMC1 cloning plasmid

CSB-CL017876HU-10ug 10ug
EUR 275
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggctgccgaggatgtggtggcgactggcgccgacccaagcgatctggagagcggcgggctgctgcatgagattttcacgtcgccgctcaacctgctgctgcttggcctctgcatcttcctgctctacaagatcgtgcgcggggaccagccggcggccagcggcgacagcgacga
  • Show more
Description: A cloning plasmid for the PGRMC1 gene.

PGRMC2 cloning plasmid

CSB-CL017877HU-10ug 10ug
EUR 297
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atggcggctggtgatggggacgtgaagctaggcaccctggggagtggcagcgagagcagcaacgacggcggcagcgagagtccaggcgacgcgggagcggcagcggaagggggaggctgggcggcggcggcgttggcgcttctgacggggggcggggaaatgctgctgaacgtggc
  • Show more
Description: A cloning plasmid for the PGRMC2 gene.

PHACTR3 cloning plasmid

CSB-CL017882HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1680
  • Sequence: atggccgcgtcggaggacgggagcggctgcctcgtgtcgcggggccgctcgcagagtgaccccagcgtcctcaccgactcctcggccacctcctccgcggacgccggggagaacccagatgagatggaccaaacgcccccggcgcgtcctgaatatctggtctcagggattcgaa
  • Show more
Description: A cloning plasmid for the PHACTR3 gene.

PHACTR4 cloning plasmid

CSB-CL017883HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2109
  • Sequence: atggaagatccatttgaggaagcagaccagcccactacagagccaggcatggtcctggacagtgtggaagcaggagacacaacacctcctaccaaaaggaagagcaagttctcaggctttggcaagatcttcaagccctggaaatggaggaaaaaaaaaagtagtgataaattta
  • Show more
Description: A cloning plasmid for the PHACTR4 gene.

PHACTR4 cloning plasmid

CSB-CL017883HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggtcctggacagtgtggaagcaggagacacaacacctcctaccaaaaggaagagcaagttctcaggctttggcaagatcttcaagccctggaaatggaggaaaaaaaaaagtagtgataaatttaaagagacttcagaagttttagaacggaaaatatctatgcgaaagccaa
  • Show more
Description: A cloning plasmid for the PHACTR4 gene.

PHB cloning plasmid

CSB-CL017885HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atggctgccaaagtgtttgagtccattggcaagtttggcctggccttagctgttgcaggaggcgtggtgaactctgccttatataatgtggatgctgggcacagagctgtcatctttgaccgattccgtggagtgcaggacattgtggtaggggaagggactcattttctcatccc
  • Show more
Description: A cloning plasmid for the PHB gene.

PHC1 cloning plasmid

CSB-CL017891HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgccaggtacagtgcagtctggtcaggcccatttggcctcctcgccaccttcatcccaggctcctggtgcactgcaggagtgccctcccacattggcccctgggatgacccttgctcctgtgcaggggacagcacatgtggtaaagggtggggctaccacctcctcacctgttg
  • Show more
Description: A cloning plasmid for the PHC1 gene.

PHF1 cloning plasmid

CSB-CL017897HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atggcgcagcccccccggctgagccgctctggtgcctcctcactttgggacccagcttctcctgctcccacctctggccccaggcctcggctttgggagggtcaagatgtgctggccagatggactgatgggctgctatacttgggtaccatcaaaaaggtggacagtgctaggg
  • Show more
Description: A cloning plasmid for the PHF1 gene.

PHF10 cloning plasmid

CSB-CL017898HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgcttcaagaacaagtcagtgaatatttgggtgtgacctcctttaaaaggaaatatccagagcgacgagatttgtctcacaaggagaaactctacctgagagagctaaatgtcattactgaaactcagtgcactctaggcttaacagcattgcgcagtgatgaagtgattgatt
  • Show more
Description: A cloning plasmid for the PHF10 gene.

PHF11 cloning plasmid

CSB-CL017900HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atggaaaaaaggacatgtgcactctgccccaaagatgtcgaatataatgtcctgtactttgcacaatcagagaatatagctgctcatgagaattgtttgctgtattcttcaggacttgtggaatgtgaggatcaggatccacttaatcctgatagaagttttgatgtggaatcagt
  • Show more
Description: A cloning plasmid for the PHF11 gene.

PHF12 cloning plasmid

CSB-CL017901HU-10ug 10ug
EUR 702
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2115
  • Sequence: ATGTGGGAGAAAATGGAGACCAAGACGATCGTGTACGACTTGGACACATCAGGGGGGCTGATGGAGCAAATCCAAGCTCTGCTGGCTCCCCCCAAGACGGACGAGGCAGAAAAGCGCAGTCGGAAGCCTGAGAAGGAGCCCCGGAGAAGCGGCAGGGCCACCAACCACGACAGCT
  • Show more
Description: A cloning plasmid for the PHF12 gene.

PHF13 cloning plasmid

CSB-CL017902HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 903
  • Sequence: atggactctgactcttgcgccgccgccttccacccggaggaatactcccccagttgcgagaggcgcaggaccgtggaagacttcaacaaattctgcacctttgtcttggcctatgctggctacatcccttatccgaaggaggaactccctttaaggagcagccccagccctgctaa
  • Show more
Description: A cloning plasmid for the PHF13 gene.

PHF19 cloning plasmid

CSB-CL017907HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggagaatcgagctctggatccagggactcgggactcctatggtgccaccagccacctccccaacaagggggccctggcgaaggtcaagaacaacttcaaagacttgatgtccaaactgacggagggccagtatgtgctgtgccggtggacagatggcctgtactacctcgggaa
  • Show more
Description: A cloning plasmid for the PHF19 gene.

PHF19 cloning plasmid

CSB-CL017907HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1743
  • Sequence: ATGGAGAATCGAGCTCTGGATCCAGGGACTCGGGACTCCTATGGTGCCACCAGCCACCTCCCCAACAAGGGGGCCCTGGCGAAGGTCAAGAACAACTTCAAAGACTTGATGTCCAAACTGACGGAGGGCCAGTATGTGCTGTGCCGGTGGACAGATGGCCTGTACTACCTCGGGA
  • Show more
Description: A cloning plasmid for the PHF19 gene.

PHF20L1 cloning plasmid

CSB-CL017910HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgagtaaaaagcccccaaatcgccctggaatcacttttgagattggtgctcgtttggaggcactggactacttacaaaaatggtatccatcacgaattgaaaaaattgactatgaggagggcaagatgttggtccattttgagcgctggagtcatcgttatgatgagtggattta
  • Show more
Description: A cloning plasmid for the PHF20L1 gene.

PHF20L1 cloning plasmid

CSB-CL017910HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atgatccagtgtgaagagtgcttgtgttggcaacacagcgtgtgcatggggctgctggaggagagcattccagagcagtacatctgctatatctgccgggacccaccaggtcagaggtggagtgcaaaatatcgttatgataaggagtggttgaataatgggagaatgtgcgggtt
  • Show more
Description: A cloning plasmid for the PHF20L1 gene.
Comparability between main and secondary inclusions doubtlessly means that the atmosphere by which the inclusions develop influences the timing of conversion. Altogether, the Chlamydia genetic instruments described right here will profit the sphere, as we proceed to analyze the molecular mechanisms underlying Chlamydia-host interplay and pathogenesis.

Leave a Reply

Your email address will not be published. Required fields are marked *