Second generation of pepino mosaic virus vectors: improved stability in tomato and a wide range of reporter genes.

Second generation of pepino mosaic virus vectors: improved stability in tomato and a wide range of reporter genes.
Background

Vectors based mostly on plant viruses are essential instruments for purposeful genomics, mobile biology, plant genome engineering and molecular farming. We beforehand reported on the development of PepGFPvector based mostly on pepino mosaic virus (PepMV) which expressed GFP effectively and stably in vegetation of its experimental host Nicotiana benthamiana, however not in its pure host tomato. We have now ready a brand new set of PepMV-based vectors with improved stability which can be in a position to specific a variety of reporter genes, helpful for each N. benthamiana and tomato.

 

 

Outcomes

We first examined PepGFPm1 and PepGFPm2, two variants of PepGFPvectors had improved GFP expression ranges and stability in N. benthamiana however not in tomato vegetation. Subsequent, we changed GFP by DsRed or mCherry within the new vectors PepDsRed and PepmCherry, respectively; whereas PepmCherry behaved equally to PepGFPm2, PepDsRed expressed the reporter gene effectively additionally in tomato vegetation. We then used PepGFPm2 and PepDsRed to review the PepMV localization in each N. benthamiana and tomato cells. Utilizing confocal laser scanning microscopy (CLSM), we noticed attribute fluorescent our bodies in PepMV-infected cells; these our bodies had a cytoplasmic localization and appeared in shut proximity to the cell nucleus. Already at Three days post-agroinoculation there have been fluorescent our bodies in virtually each cell of agroinoculated tissues of each hosts, and all the time one physique per cell.

When markers for the endoplasmic reticulum or the Golgi equipment had been co-expressed with PepGFPm2 or PepDsRed, a reorganisation of those organelles was noticed, with photos suggesting that each are intimately associated however not the principle constituents of the PepMV our bodies. Altogether, this set of information steered that the PepMV our bodies are much like the potato virus X (PVX) “X-bodies”, which have been described because the PVX viral replication complexes (VRCs). To finish the set of PepMV-based vectors, we constructed a vector expressing the BAR herbicide resistance gene, helpful for large susceptibility screenings.

 

 

Conclusions

We have now considerably expanded the PepMV device field by producing a set of recent vectors with improved stability and effectivity in each N. benthamiana and tomato vegetation. By utilizing two of those vectors, we now have described attribute mobile our bodies induced by PepMV an infection; these our bodies are doubtless the PepMV VRCs.

 

A Artificial Plasmid Toolkit for Shewanella oneidensis MR-1.

Shewanella oneidensis MR-1 is a platform microorganism for understanding extracellular electron switch (EET) with a completely sequenced and annotated genome. Compared to different mannequin microorganisms equivalent to Escherichia coli, the obtainable plasmid elements (equivalent to promoters and replicons) are usually not adequate to conveniently and rapidly fine-tune the expression of a number of genes in S. oneidensis MR-1. Right here, we constructed and characterised a plasmid toolkit that comprises a set of expression vectors with a mixture of promoters, replicons, antibiotic resistance genes, and an RK2 origin of switch (oriT) cassette, during which every ingredient may be simply modified by mounted restriction enzyme websites. The expression cassette can also be suitable with BioBrick artificial biology requirements. Utilizing inexperienced fluorescent protein (GFP) as a reporter, we examined and quantified the energy of promoters.
The copy variety of totally different replicons was additionally measured by real-time quantitative PCR. We additional remodeled two suitable plasmids with totally different antibiotic resistance genes into the recombinant S. oneidensis MR-1, enabling management over the expression of two totally different fluorescent proteins. This plasmid toolkit was additional used for overexpression of the MtrCAB porin-c-type cytochrome complicated within the S. oneidensis ΔmtrA pressure. Tungsten trioxide (WO3) discount and microbial gasoline cell (MFC) assays revealed that the EET effectivity was improved most importantly when MtrCAB was expressed at a average stage, thus demonstrating the utility of the plasmid toolkit within the EET regulation in S. oneidensis. The plasmid toolkit developed on this examine is helpful for fast and handy fine-tuning of gene expression and enhances the power to genetically manipulate S. oneidensis MR-1.
 Second generation of pepino mosaic virus vectors: improved stability in tomato and a wide range of reporter genes.

Second generation of pepino mosaic virus vectors: improved stability in tomato and a wide range of reporter genes.

Bodily decoupling of XylS/Pm regulatory parts and conditional proteolysis allow exact management of gene expression in Pseudomonas putida.

Many of the gene expression techniques obtainable for Gram-negative micro organism are stricken by comparatively excessive ranges of basal (i.e. leaky) expression of the goal gene(s). This prevalence impacts the system dynamics, finally lowering the output and productiveness of engineered pathways and artificial circuits.
With the intention to circumvent this downside, we now have designed a novel expression system based mostly on the well-known XylS/Pm transcriptional regulator/promoter pair from the soil bacterium Pseudomonas putida mt-2, during which the important thing purposeful parts are bodily decoupled. By integrating the xylS gene into the chromosome of the platform pressure KT2440, whereas putting the Pm promoter right into a set of ordinary plasmid vectors, the inducibility of the system (i.e. the output distinction between the induced and uninduced state) improved as much as 170-fold. We additional mixed this modular system with an additional layer of post-translational management by the use of conditional proteolysis.

PAM cloning plasmid

CSB-CL017417HU-10ug 10ug
EUR 838
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2601
  • Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat
  • Show more
Description: A cloning plasmid for the PAM gene.

PANK1 cloning plasmid

CSB-CL017421HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atggcagctaaaggcgacagcaccaatgttgataaactggtgaaggacatttacggaggagactatgaacgatttggccttcaaggatctgctgtagcatcaagctttggcaacatgatgagtaaagaaaagcgagattccatcagcaaggaagacctcgcccgggccacattggt
  • Show more
Description: A cloning plasmid for the PANK1 gene.

PAPLN cloning plasmid

CSB-CL017431HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 390
  • Sequence: atgcggctgctcctgctcgtgccgctgctgctggctccagcgcccgggtcctcggctcccaaggtgaggcggcagagtgacacctggggaccctggagccagtggagcccctgcagccggacctgtggagggggtgtcagcttccgggagcgcccctgctactcccagaggagaga
  • Show more
Description: A cloning plasmid for the PAPLN gene.

PAPOLA cloning plasmid

CSB-CL017432HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgccgtttccagttacaacacagggatcacaacaaacacaaccgccacagaagcactatggcattacttctcctatcagcttagcagcccccaaggagactgactgcgtacttacacagaaactaattgagacattgaaaccctttggggtttttgaagaggaagaggaactgca
  • Show more
Description: A cloning plasmid for the PAPOLA gene.

PARK2 cloning plasmid

CSB-CL017451HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atgatagtgtttgtcaggttcaactccagccatggtttcccagtggaggtcgattctgacaccagcatcttccagctcaaggaggtggttgctaagcgacagggggttccggctgaccagttgcgtgtgattttcgcagggaaggagctgaggaatgactggactgtgcagaatt
  • Show more
Description: A cloning plasmid for the PARK2 gene.

PARN cloning plasmid

CSB-CL017456HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1920
  • Sequence: atggagataatcaggagcaattttaagagtaatcttcacaaagtgtaccaggccatagaggaggccgacttcttcgccatcgatggggagttttcaggaatcagtgatggaccttcagtctctgcattaacaaatggttttgacactccagaagagaggtatcagaagcttaaaa
  • Show more
Description: A cloning plasmid for the PARN gene.

PAX3 cloning plasmid

CSB-CL017489HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagat
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX3 cloning plasmid

CSB-CL017489HU2-10ug 10ug
EUR 517
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGCGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX4 cloning plasmid

CSB-CL017490HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: ATGGCCTGGTCCAGTAAGTCTTGGCTTTGTCTTATAGCCTCCTCCTGTCCCAGGGACACTCTCCTTCCTTCTGCCCATCATGCCTCACCTGTCCCTGCTTCTCACCTGACTCAGGTATCTAATGGCTGTGTGAGCAAGATCCTAGGGCGTTACTACCGCACAGGTGTCTTGGAGCC
  • Show more
Description: A cloning plasmid for the PAX4 gene.

PAX6 cloning plasmid

CSB-CL017492HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1267
  • Sequence: atgcagaacagtcacagcggagtgaatcagctcggtggtgtctttgtcaacgggcggccactgccggactccacccggcagaagattgtagagctagctcacagcggggcccggccgtgcgacatttcccgaattctgcaggtgtccaacggatgtgtgagtaaaattctgggca
  • Show more
Description: A cloning plasmid for the PAX6 gene.

PAX7 cloning plasmid

CSB-CL017493HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: ATGGCGGCCCTTCCCGGCACGGTACCGAGAATGATGCGGCCGGCTCCGGGGCAGAACTACCCCCGCACGGGATTCCCTTTGGAAGTGTCCACCCCGCTTGGCCAAGGCCGGGTCAATCAGCTGGGAGGGGTCTTCATCAATGGGCGACCCCTGCCTAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX7 gene.

PAX8 cloning plasmid

CSB-CL017494HU-10ug 10ug
EUR 489
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1353
  • Sequence: atgcctcacaactccatcagatctggccatggagggctgaaccagctgggaggggcctttgtgaatggcagacctctgccggaagtggtccgccagcgcatcgtagacctggcccaccagggtgtaaggccctgcgacatctctcgccagctccgcgtcagccatggctgcgtca
  • Show more
Description: A cloning plasmid for the PAX8 gene.

PBLD cloning plasmid

CSB-CL017501HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 867
  • Sequence: atgaagcttcctattttcatagcagatgcattcacagcaagagcatttcgtgggaatcctgctgctgtttgcctcctagaaaatgaattggatgaagacatgcatcagaaaattgcaagggagatgaacctctctgaaactgcttttatccgaaaactgcacccgacagacaactt
  • Show more
Description: A cloning plasmid for the PBLD gene.

PBX2 cloning plasmid

CSB-CL017506HU1-10ug 10ug
EUR 404
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.

PBX2 cloning plasmid

CSB-CL017506HU2-10ug 10ug
EUR 472
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.

PBX3 cloning plasmid

CSB-CL017507HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 825
  • Sequence: atgaaccttctccgagaacagagtagaacacgtcccatttctccaaaagagattgaaagaatggtgggcatcatccatcgaaaatttagttccattcagatgcagctcaaacaaagcacttgtgaagcagttatgattttaagatcaaggttccttgatgccagacggaaaaggcg
  • Show more
Description: A cloning plasmid for the PBX3 gene.

PC cloning plasmid

CSB-CL017511HU-10ug 10ug
EUR 1252
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3537
  • Sequence: atgctgaagttccgaacagtccatgggggcctgaggctcctgggaatccgccgaacctccaccgcccccgctgcctccccaaatgtccggcgcctggagtataagcccatcaagaaagtcatggtggccaacagaggtgagattgccatccgtgtgttccgggcctgcacggagc
  • Show more
Description: A cloning plasmid for the PC gene.

PCBD1 cloning plasmid

CSB-CL017514HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atggctggcaaagcacacaggctgagcgctgaggagagggaccagctgctgccaaacctgagggctgtggggtggaatgagctggaaggccgtgatgccatcttcaagcagtttcatttcaaagacttcaacagggcctttgggttcatgacaagagtggccctgcaggctgagaa
  • Show more
Description: A cloning plasmid for the PCBD1 gene.

PCBP4 cloning plasmid

CSB-CL017521HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgagcggctcggacgggggactggaggaggagccagagctcagcatcaccctcacgctgcggatgctgatgcacgggaaggaagtgggcagcatcatcgggaagaagggcgagactgtaaagcgaatccgggagcagagcagtgcccggatcaccatctccgagggctcctgcc
  • Show more
Description: A cloning plasmid for the PCBP4 gene.

PCCB cloning plasmid

CSB-CL017523HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1620
  • Sequence: atggcggcggcattacgggtggcggcggtcggggcaaggctcagcgttctggcgagcggtctccgcgccgcggtccgcagcctttgcagccaggccacctctgttaacgaacgcatcgaaaacaagcgccggaccgcgctgctgggagggggccaacgccgtattgacgcgcagc
  • Show more
Description: A cloning plasmid for the PCCB gene.

PCDH8 cloning plasmid

CSB-CL017537HU-10ug 10ug
EUR 1147
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3213
  • Sequence: atgagtcctgtgaggcgttggggcagcccctgccttttccccttgcagctcttcagcctctgctgggtgctctcagtggcccagagcaaaacagtccgatacagcaccttcgaggaggatgcccccggcacggtcatcgggaccctggccgaggacctgcacatgaaagtatcgg
  • Show more
Description: A cloning plasmid for the PCDH8 gene.

PCF11 cloning plasmid

CSB-CL017603HU-10ug 10ug
EUR 1819
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4668
  • Sequence: ATGTCAGAGCAGACGCCGGCCGAGGCCGGTGCTGCGGGGGCCCGGGAGGACGCCTGTCGGGATTATCAGTCATCGCTCGAAGACCTGACCTTCAATAGCAAGCCGCACATCAATATGCTGACCATTCTAGCCGAGGAGAACCTGCCCTTCGCCAAGGAGATCGTCTCTCTCATCG
  • Show more
Description: A cloning plasmid for the PCF11 gene.

PCGF2 cloning plasmid

CSB-CL017606HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atgcatcggactacacggatcaaaatcacagagctgaacccccacctcatgtgtgccctctgcggggggtacttcatcgacgccaccactatcgtggagtgcctgcattccttctgcaaaacctgcatcgtgcgctacctggagaccaacaaatactgccccatgtgtgacgtgc
  • Show more
Description: A cloning plasmid for the PCGF2 gene.

PCMT1 cloning plasmid

CSB-CL017618HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atggcctggaaatccggcggcgccagccactcggagctaatccacaatctccgcaaaaatggaatcatcaagacagataaagtatttgaagtgatgctggctacagaccgctcccactatgcaaaatgtaacccatacatggattctccacaatcaataggtttccaagcaacaat
  • Show more
Description: A cloning plasmid for the PCMT1 gene.

PCNA cloning plasmid

CSB-CL017621HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 786
  • Sequence: atgttcgaggcgcgcctggtccagggctccatcctcaagaaggtgttggaggcactcaaggacctcatcaacgaggcctgctgggatattagctccagcggtgtaaacctgcagagcatggactcgtcccacgtctctttggtgcagctcaccctgcggtctgagggcttcgacac
  • Show more
Description: A cloning plasmid for the PCNA gene.

PCNXL2 cloning plasmid

CSB-CL017629HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 915
  • Sequence: atgctgttttttggtggttctgctgtgtctgggataacctcggctgtttacagtgtggcccggagcgtcttggctgccgccctgctccacgcagtctgcttcagtgcagtgaaggaaccgtggagcatgcaacacatcccggcactgttttcggccttctgtggcctcttggtcgc
  • Show more
Description: A cloning plasmid for the PCNXL2 gene.

PCOLCE2 cloning plasmid

CSB-CL017632HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 831
  • Sequence: atgaggggcgcgaacgcctgggcgccactctgcctgctgctggctgccgccacccagctctcgcggcagcagtccccagagagacctgttttcacatgtggtggcattcttactggagagtctggatttattggcagtgaaggttttcctggagtgtaccctccaaatagcaaatg
  • Show more
Description: A cloning plasmid for the PCOLCE2 gene.

PCP4 cloning plasmid

CSB-CL017636HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 189
  • Sequence: atgagtgagcgacaaggtgctggggcaaccaatggaaaagacaagacatctggtgaaaatgatggacagaagaaagttcaagaagaatttgacattgacatggatgcaccagagacagaacgtgcagcggtggccattcagtctcagttcagaaaattccagaagaagaaggctgg
  • Show more
Description: A cloning plasmid for the PCP4 gene.

PCSK1 cloning plasmid

CSB-CL017640HU-10ug 10ug
EUR 742
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2262
  • Sequence: atggagcgaagagcctggagtctgcagtgcactgctttcgtcctcttttgcgcttggtgtgcactgaacagtgcaaaagcgaaaaggcaatttgtcaatgaatgggcagcggagatccccgggggcccggaagcagcctcggccatcgccgaggagctgggctatgaccttttgg
  • Show more
Description: A cloning plasmid for the PCSK1 gene.

PCSK4 cloning plasmid

CSB-CL017643HU-10ug 10ug
EUR 314
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atgggcacgcgctccacactcgtggccatacgacccttggacgtcagcactgaaggctacaacaactgggtcttcatgtccacccacttctgggatgagaacccacagggcgtgtggaccctgggcctagagaacaagggctactatttcaacacggggacgttgtaccgctacac
  • Show more
Description: A cloning plasmid for the PCSK4 gene.

PCSK5 cloning plasmid

CSB-CL017644HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2742
  • Sequence: atgggctgggggagccgctgctgctgcccgggacgtttggacctgctgtgcgtgctggcgctgctcgggggctgcctgctccccgtgtgtcggacgcgcgtctacaccaaccactgggcagtcaaaatcgccgggggcttcccggaggccaaccgtatcgccagcaagtacggat
  • Show more
Description: A cloning plasmid for the PCSK5 gene.

PCSK7 cloning plasmid

CSB-CL017646HU-10ug 10ug
EUR 607
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atgccgaaggggaggcagaaagtgccacacttggatgcccccctgggcctgcccacctgcctctggctggaattagccgggctcttcttactggttccctgggtcatgggcctggcagggacaggtgggcctgatggccagggcacaggggggccgagctgggctgtgcacctgg
  • Show more
Description: A cloning plasmid for the PCSK7 gene.

PCTP cloning plasmid

CSB-CL017651HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atggagctggccgccggaagcttctcggaggagcagttctgggaggcctgcgccgagctccagcagcccgctctggccggggccgactggcagctcctagtggagacctcgggcatcagcatctaccggctgctggacaagaagactggactttatgagtataaagtctttggtgt
  • Show more
Description: A cloning plasmid for the PCTP gene.

PCYOX1 cloning plasmid

CSB-CL017652HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atggggcgcgtcgtcgcggagcttgtctcctcgctgctggggttgtggctgttgctgtgcagctgcggatgccccgagggcgccgagctgcgtgctccgccagataaaatcgcgattattggagccggaattggtggcacttcagcagcctattacctgcggcagaaatttggga
  • Show more
Description: A cloning plasmid for the PCYOX1 gene.

PDCD1LG2 cloning plasmid

CSB-CL017667HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 822
  • Sequence: atgatcttcctcctgctaatgttgagcctggaattgcagcttcaccagatagcagctttattcacagtgacagtccctaaggaactgtacataatagagcatggcagcaatgtgaccctggaatgcaactttgacactggaagtcatgtgaaccttggagcaataacagccagttt
  • Show more
Description: A cloning plasmid for the PDCD1LG2 gene.

PDCD5 cloning plasmid

CSB-CL017671HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaactt
  • Show more
Description: A cloning plasmid for the PDCD5 gene.

PDCD6 cloning plasmid

CSB-CL017672HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: atggccgcctactcttaccgccccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactccctttaatccagt
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDCD6 cloning plasmid

CSB-CL017672HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: atggccgcctactcttaccgccccggccctggggccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactcc
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDCD6 cloning plasmid

CSB-CL017672HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: ATGGCCGCCTACTCTTACCGCCCCGGCCCTGGGGCCGGCCCTGGGCCTGCTGCAGGCGCGGCGCTGCCGGACCAGAGCTTCCTGTGGAACGTTTTCCAGAGGGTCGATAAAGACAGGAGTGGAGTGATATCAGACACCGAGCTTCAGCAAGCTCTCTCCAACGGCACGTGGACTCC
  • Show more
Description: A cloning plasmid for the PDCD6 gene.

PDGFB cloning plasmid

CSB-CL017709HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 726
  • Sequence: atgaatcgctgctgggcgctcttcctgtctctctgctgctacctgcgtctggtcagcgccgagggggaccccattcccgaggagctttatgagatgctgagtgaccactcgatccgctcctttgatgatctccaacgcctgctgcacggagaccccggagaggaagatggggccga
  • Show more
Description: A cloning plasmid for the PDGFB gene.

PDGFRA cloning plasmid

CSB-CL017712HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atggggacttcccatccggcgttcctggtcttaggctgtcttctcacagggctgagcctaatcctctgccagctttcattaccctctatccttccaaatgaaaatgaaaaggttgtgcagctgaattcatccttttctctgagatgctttggggagagtgaagtgagctggcagta
  • Show more
Description: A cloning plasmid for the PDGFRA gene.

PDGFRB cloning plasmid

CSB-CL017713HU-10ug 10ug
EUR 1217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3321
  • Sequence: atgcggcttccgggtgcgatgccagctctggccctcaaaggcgagctgctgttgctgtctctcctgttacttctggaaccacagatctctcagggcctggtcgtcacacccccggggccagagcttgtcctcaatgtctccagcaccttcgttctgacctgctcgggttcagctc
  • Show more
Description: A cloning plasmid for the PDGFRB gene.

PDHA1 cloning plasmid

CSB-CL017715HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgaggaagatgctcgccgccgtctcccgcgtgctgtctggcgcttctcagaagccggcaagcagagtgctggtagcatcccgtaattttgcaaatgatgctacatttgaaattaagaaatgtgaccttcaccggctggaagaaggccctcctgtcacaacagtgctcaccaggg
  • Show more
Description: A cloning plasmid for the PDHA1 gene.

PDHA2 cloning plasmid

CSB-CL017716HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: ATGCTGGCCGCCTTCATCTCCCGCGTGTTGAGGCGAGTTGCCCAGAAATCAGCTCGCAGAGTGCTGGTGGCATCCCGTAACTCCTCAAATGACGCTACATTTGAAATTAAGAAATGTGATCTTTATCTGTTGGAAGAGGGTCCCCCTGTCACTACAGTGCTCACTAGGGCGGAGG
  • Show more
Description: A cloning plasmid for the PDHA2 gene.

PDHA2 cloning plasmid

CSB-CL017716HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: ATGCTGGCCGCCTTCATCTCCCGCGTGTTGAGGCGAGTTGCCCAGAAATCAGCTCGCAGAGTGCTGGTGGCATCCCGTAACTCCTCAAATGACGCTACATTTGAAATTAAGAAATGTGATCTTTATCTGTTGGAAGAGGGTCCCCCTGTCACTACAGTGCTCACTAGGGCGGAGG
  • Show more
Description: A cloning plasmid for the PDHA2 gene.

PDHB cloning plasmid

CSB-CL017717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atggcggcggtgtctggcttggtgcggagaccccttcgggaggtctccgggctgctgaagaggcgctttcactggaccgcgccggctgcgctgcaggtgacagttcgtgatgctataaatcagggtatggatgaggagctggaaagagatgagaaggtatttctgcttggagaag
  • Show more
Description: A cloning plasmid for the PDHB gene.

PDHX cloning plasmid

CSB-CL017718HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1506
  • Sequence: atggcggcctcctggaggctgggctgtgatccgcggctgctgcgttatcttgtgggcttccctggccgccgaagcgtagggctggtgaagggggctcttgggtggtctgtaagccgcggagctaattggagatggtttcacagcacgcagtggcttcggggtgatcccattaaga
  • Show more
Description: A cloning plasmid for the PDHX gene.

PDIA3 cloning plasmid

CSB-CL017720HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgcgcctccgccgcctagcgctgttcccgggtgtggcgctgcttcttgccgcggcccgcctcgccgctgcctccgacgtgctagaactcacggacgacaacttcgagagtcgcatctccgacacgggctctgcgggcctcatgctcgtcgagttcttcgccccctggtgtggac
  • Show more
Description: A cloning plasmid for the PDIA3 gene.

PDIA3 cloning plasmid

CSB-CL017720HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgcgcctccgccgcctagcgctgttcccgggtgtggcgctgcttcttgccgcggcccgcctcgccgctgcctccgacgtgctagaactcacggacgacaacttcgagagtcgcatctccgacacgggctctgcgggcctcatgctcgtcgagttcttcgctccctggtgtggac
  • Show more
Description: A cloning plasmid for the PDIA3 gene.

PDIA4 cloning plasmid

CSB-CL017722HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1938
  • Sequence: atgaggccccggaaagccttcctgctcctgctgctcttggggctggtgcagctgctggccgtggcgggtgccgagggcccggacgaggattcttctaacagagaaaatgccattgaggatgaagaggaggaggaggaggaagatgatgatgaggaagaagacgacttggaagtta
  • Show more
Description: A cloning plasmid for the PDIA4 gene.

PDLIM1 cloning plasmid

CSB-CL017731HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atgaccacccagcagatagacctccagggcccggggccgtggggcttccgcctcgtgggcggcaaggacttcgagcagcctctcgccatttcccgggtcactcctggaagcaaggcggctctagctaatttatgtattggagatgtaatcacagccattgatggggaaaatactag
  • Show more
Description: A cloning plasmid for the PDLIM1 gene.

PDLIM4 cloning plasmid

CSB-CL017735HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 993
  • Sequence: atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagct
  • Show more
Description: A cloning plasmid for the PDLIM4 gene.

PDLIM4 cloning plasmid

CSB-CL017735HU2-10ug 10ug
EUR 317
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagct
  • Show more
Description: A cloning plasmid for the PDLIM4 gene.

PDPK1 cloning plasmid

CSB-CL017738HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atggccaggaccaccagccagctgtatgacgccgtgcccatccagtccagcgtggtgttatgttcctgcccatccccatcaatggtgaggacccagactgagtccagcacgccccctggcattcctggtggcagcaggcagggccccgccatggacggcactgcagccgagcctc
  • Show more
Description: A cloning plasmid for the PDPK1 gene.

PDPN cloning plasmid

CSB-CL017739HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 489
  • Sequence: atgtggaaggtgtcagctctgctcttcgttttgggaagcgcgtcgctctgggtcctggcagaaggagccagcacaggccagccagaagatgacactgagactacaggtttggaaggcggcgttgccatgccaggtgccgaagatgatgtggtgactccaggaaccagcgaagaccg
  • Show more
Description: A cloning plasmid for the PDPN gene.

PDXK cloning plasmid

CSB-CL017748HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atggaggaggagtgccgggtgctctccatacagagccacgtcatccgcggctacgtgggcaaccgggcggccacgttcccgctgcaggttttgggatttgagattgacgcggtgaactctgtccagttttcaaaccacacaggctatgcccactggaagggccaagtgctgaattc
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDXK cloning plasmid

CSB-CL017748HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 687
  • Sequence: atgtccccttccatctctgacccttgcctgggacaagctttgatggggggccccagcttcaaggctgtggtgggaacagcacccccaaatgccagcctctcctttcttcccatccaccagtatactgcggggccatttctggtctttgtccaacaggaaacccatttctggtggga
  • Show more
Description: A cloning plasmid for the PDXK gene.

PDYN cloning plasmid

CSB-CL017750HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggcctggcaggggctggtcctggctgcctgcctcctcatgttcccctccaccacagcggactgcctgtcgcggtgctccttgtgtgctgtaaagacccaggatggtcccaaacctatcaatcccctgatttgctccctgcaatgccaggctgccctgctgccctctgaggaatg
  • Show more
Description: A cloning plasmid for the PDYN gene.

PEBP1 cloning plasmid

CSB-CL017766HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 564
  • Sequence: atgccggtggacctcagcaagtggtccgggcccttgagcctgcaagaagtggacgagcagccgcagcacccactgcatgtcacctacgccggggcggcggtggacgagctgggcaaagtgctgacgcccacccaggttaagaatagacccaccagcatttcgtgggatggtcttga
  • Show more
Description: A cloning plasmid for the PEBP1 gene.

PECR cloning plasmid

CSB-CL017769HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atggcctcctgggctaagggcaggagctacctggcgcctggtttgctgcagggccaagtggccatcgtcaccggcggggccacgggcatcggaaaagccatcgtgaaggagctcctggagctggggagtaatgtggtcattgcatcccgtaagttggagagattgaagtctgcggc
  • Show more
Description: A cloning plasmid for the PECR gene.

PEMT cloning plasmid

CSB-CL017780HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atgaagagatctgggaacccgggagccgaggtaacgaacagctcggtggcagggcctgactgctgcggaggcctcggcaatattgattttagacaggcagacttctgcgttatgacccggctgctgggctacgtggaccccctggatcccagctttgtggctgccgtcatcaccat
  • Show more
Description: A cloning plasmid for the PEMT gene.

PEMT cloning plasmid

CSB-CL017780HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atgaagagatctgggaacccgggagccgaggtaacgaacagctcggtggcagggcctgactgctgcggaggcctcggcaatattgattttagacaggcagacttctgcgttatgacccggctgctgggctacgtggaccccctggatcccagctttgtggctgctgtcatcaccat
  • Show more
Description: A cloning plasmid for the PEMT gene.

PENK cloning plasmid

CSB-CL017781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 804
  • Sequence: atggcgcggttcctgacactttgcacttggctgctgttgctcggccccgggctcctggcgaccgtgcgggccgaatgcagccaggattgcgcgacgtgcagctaccgcctagtgcgcccggccgacatcaacttcctggcttgcgtaatggaatgtgaaggtaaactgccttctct
  • Show more
Description: A cloning plasmid for the PENK gene.

PEPD cloning plasmid

CSB-CL017784HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.

PEPD cloning plasmid

CSB-CL017784HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggcggcggccaccggaccctcgttttggctggggaatgaaaccctgaaggtgccgctggcgctctttgccttgaaccggcagcgcctgtgtgagcggctgcggaagaaccctgctgtgcaggccggctccatcgtggtcctgcagggcggggaggagactcagcgctactgca
  • Show more
Description: A cloning plasmid for the PEPD gene.

PER1 cloning plasmid

CSB-CL017786HU1-10ug 10ug
EUR 591
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atgagtggccccctagaaggggctgatgggggaggggaccccaggcctggggaatcattttgtcctgggggcgtcccatcccctgggcccccacagcaccggccttgcccaggccccagcctggccgatgacaccgatgccaacagcaatggttcaagtggcaatgagtccaacg
  • Show more
Description: A cloning plasmid for the PER1 gene.

PER1 cloning plasmid

CSB-CL017786HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 885
  • Sequence: atgagtggccccctagaaggggctgatgggggaggggaccccaggcctggggaatcattttgtcctgggggcgtcccatcccctgggcccccacagcaccggccttgcccaggccccagcctggccgatgacaccgatgccaacagcaatggttcaagtggcaatgagtccaacgg
  • Show more
Description: A cloning plasmid for the PER1 gene.

PER3 cloning plasmid

CSB-CL017788HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1137
  • Sequence: atgccccgcggggaagctcctggccccgggagacggggggctaaggacgaggccctgggcgaagaatcgggggagcggtggagccccgagttccatctgcagaggaaattggcggacagcagccacagtgaacagcaagatcgaaacagagtttctgaagaacttatcatggttg
  • Show more
Description: A cloning plasmid for the PER3 gene.

PES1 cloning plasmid

CSB-CL017791HU-10ug 10ug
EUR 604
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1767
  • Sequence: atgggaggccttgagaagaagaagtatgaacgaggctcggccaccaactacatcacccggaacaaagcccggaagaagctccagctgagcttggctgactttaggcggctgtgcattctgaagggcatttatccccatgaacccaaacacaagaagaaggttaacaagggttcta
  • Show more
Description: A cloning plasmid for the PES1 gene.

PEX10 cloning plasmid

CSB-CL017794HU1-10ug 10ug
EUR 384
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttgg
  • Show more
Description: A cloning plasmid for the PEX10 gene.

PEX10 cloning plasmid

CSB-CL017794HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atggccccggccgccgccagccccccggaggtgatccgcgcggcgcagaaggacgagtactaccgcggtgggctgcggagcgcggcgggcggcgccctgcacagcctggcgggtgcgaggaagtggctggagtggaggaaggaggttgagctgctctcagatgtggcctactttg
  • Show more
Description: A cloning plasmid for the PEX10 gene.

PEX11A cloning plasmid

CSB-CL017795HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atggacgccttcacccgcttcaccaaccagacccagggccgggaccgactcttcagagccactcagtacacatgcatgttgcttagatatttgttagagcccaaagctggcaaagagaaggtggtaatgaagctcaagaaactggagtccagtgtgagcactggtcgtaaatggtt
  • Show more
Description: A cloning plasmid for the PEX11A gene.

PEX11A cloning plasmid

CSB-CL017795HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGAAGTCCGCGCTTTTCACCCGCTTCACCAACCAGACCCAGGGCCGGGACCGACTCTTCAGAGCCACTCAGTACACATGCATGTTGCTTAGATATTTGTTAGAGCCCAAAGCTGGCAAAGAGAAGGTGGTAATGAAGCTCAAGAAACTGGAGTCCAGTGTGAGCACTGGTCGTAA
  • Show more
Description: A cloning plasmid for the PEX11A gene.

PEX11B cloning plasmid

CSB-CL017796HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 780
  • Sequence: atggacgcctgggtccgcttcagtgctcagagccaagcccgggagcggctgtgtagggccgcccagtatgcttgctctcttcttggccatgcgctgcagaggcatggagccagtcctgagttacagaaacagattcgacaactggagagccacctgagccttggaagaaagcttct
  • Show more
Description: A cloning plasmid for the PEX11B gene.

PEX14 cloning plasmid

CSB-CL017800HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atggcgtcctcggagcaggcagagcagccgagccagccaagctctactccaggaagtgaaaatgtgctgcctcgagagccgctgattgccacggcagtgaagtttctacagaattcccgggtccgccagagcccacttgcaaccaggagagcattcctaaagaagaaagggctga
  • Show more
Description: A cloning plasmid for the PEX14 gene.

PEX19 cloning plasmid

CSB-CL017802HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 900
  • Sequence: atggccgccgctgaggaaggctgtagtgtcggggccgaagcggacagggaattggaggagcttctggaaagtgctcttgatgatttcgataaagccaaaccctccccagcacccccttctaccaccacggcccctgatgcttcggggccccagaagagatcgccaggagacactgc
  • Show more
Description: A cloning plasmid for the PEX19 gene.

PEX3 cloning plasmid

CSB-CL017804HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: atgctgaggtctgtatggaattttctgaaacgccacaaaaagaaatgcatcttcctgggcacggtccttggaggagtatatattctggggaaatatggacagaagaaaatcagagaaatacaggaaagggaggctgcagaatacattgcccaagcacgacgacaatatcattttg
  • Show more
Description: A cloning plasmid for the PEX3 gene.

PEX5 cloning plasmid

CSB-CL017805HU-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1896
  • Sequence: atggcaatgcgggagctggtggaggccgaatgcgggggtgccaacccgctcatgaagctcgccgggcacttcacccaggacaaggcccttcggcaggagggattgaggcctggcccctggccccccggagccccggcctctgaggcagcctccaagcctttgggagtagcttctg
  • Show more
Description: A cloning plasmid for the PEX5 gene.

PEX7 cloning plasmid

CSB-CL017808HU1-10ug 10ug
EUR 346
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaag
  • Show more
Description: A cloning plasmid for the PEX7 gene.

PEX7 cloning plasmid

CSB-CL017808HU2-10ug 10ug
EUR 381
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atgagtgcggtgtgcggtggagcggcgcggatgctgcggacgccgggacgccacggctacgccgccgagttctccccgtacctgccgggccgcctggcctgcgccaccgcgcagcactacggcatcgcgggctgtggaaccctactaatattggatccagatgaagctgggctaag
  • Show more
Description: A cloning plasmid for the PEX7 gene.

PF4V1 cloning plasmid

CSB-CL017810HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgagctccgcagccaggtcccgcctcacccgcgccacccgccaggagatgctgttcttggcgttgctgctcctgccagttgtggtcgccttcgccagagctgaagctgaagaagatggggacctgcagtgcctgtgtgtgaagaccacctcccaggtccgtcccaggcacatcac
  • Show more
Description: A cloning plasmid for the PF4V1 gene.

PFDN1 cloning plasmid

CSB-CL017812HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atggccgcccccgtggatctagagctgaagaaggccttcacagagcttcaagccaaagttattgacactcaacagaaggtgaagctcgcagacatacagattgaacagctaaacagaacgaaaaagcatgcacatcttacagatacagagatcatgactttggtagatgagactaa
  • Show more
Description: A cloning plasmid for the PFDN1 gene.

PFDN2 cloning plasmid

CSB-CL017813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcggagaacagcggtcgcgccggcaagagcagcgggagcggcgcggggaagggggcggtgtccgcagagcaggtgattgctggcttcaaccgccttcggcaggaacagcgaggcctggcatccaaagcagctgagttggagatggagttgaatgagcacagcctagtgatcga
  • Show more
Description: A cloning plasmid for the PFDN2 gene.

PFDN4 cloning plasmid

CSB-CL017814HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atggcggccaccatgaagaaggcggctgcagaagatgtcaatgttactttcgaagatcaacaaaagataaacaaatttgcacggaatacaagtagaatcacagagctgaaggaagaaatagaagtaaaaaagaaacaactccaaaacctagaagatgcttgtgatgacatcatgct
  • Show more
Description: A cloning plasmid for the PFDN4 gene.

PFDN5 cloning plasmid

CSB-CL017815HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcgcagtctattaacatcacggagctgaatctgccgcagctagaaatgctcaagaaccagctggaccaggaagtggagttcttgtccacgtccattgctcagctcaaagtggtacagaccaagtatgtggaagccaaggactgtctgaacgtgctgaacaagagcaacgaggg
  • Show more
Description: A cloning plasmid for the PFDN5 gene.

PFKFB1 cloning plasmid

CSB-CL017817HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1416
  • Sequence: ATGTCTCCAGAGATGGGAGAGCTCACCCAAACCAGGTTGCAGAAGATCTGGATTCCACACAGCAGCGGCAGCAGCAGGCTGCAACGGAGAAGGGGCTCATCCATACCCCAGTTTACCAATTCCCCCACAATGGTGATCATGGTGGGTTTACCAGCTCGAGGCAAGACCTATATCT
  • Show more
Description: A cloning plasmid for the PFKFB1 gene.

PFKL cloning plasmid

CSB-CL017821HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atggccgcggtggacctggagaagctgcgggcgtcgggcgcgggcaaggccatcggcgtcctgaccagcggcggcgacgcgcaaggcatgaacgctgctgtccgggctgtgacgcgcatgggcatttatgtgggtgccaaagtcttcctcatctacgagggctatgagggcctcg
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atggccgcggtggacctggagaagctgcgggcgtcgggcgcgggcaaggccatcggcgtcctgaccagcggcggcgacgcgcaaggcatgaacgctgctgtccgggctgtgacgcgcatgggcatttatgtgggtgccaaagtcttcctcatctacgagggctatgagggcctcg
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU3-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2484
  • Sequence: atgtgtaaccagggtagaggtcgagagtcctctcgtgggggtctccatgttcaagggagctgccgaggcttgagcaggagcccccagcaggaaactggctttgccaaggcccccgctgggacagactgtttctttcactgcagtcctgggagccgagggcaaggggacaggaaag
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKL cloning plasmid

CSB-CL017821HU4-10ug 10ug
EUR 502
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atgggcatggaggcggtgatggcgctgctggaagccacgcctgacacgccggcctgcgtggtcaccctctcggggaaccagtcagtgcggctgcccctcatggagtgcgtgcagatgaccaaggaagtgcagaaagccatggatgacaagaggtttgacgaggccacccagctcc
  • Show more
Description: A cloning plasmid for the PFKL gene.

PFKM cloning plasmid

CSB-CL017822HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atgacccatgaagagcaccatgcagccaaaaccctggggattggcaaagccattgctgtcttaacctctggtggagatgcccaaggtatgaatgctgctgtcagggctgtggttcgagttggtatcttcaccggtgcccgtgtcttctttgtccatgagggttatcaaggcctgg
  • Show more
Description: A cloning plasmid for the PFKM gene.

PFKM cloning plasmid

CSB-CL017822HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atgacccatgaagagcaccatgcagccaaaaccctggggattggcaaagccattgctgtcttaacctctggtggagatgcccaaggtatgaatgctgctgtcagggctgtggttcgagttggtatcttcaccggtgcccgtgtcttctttgtccatgagggttatcaaggcctgg
  • Show more
Description: A cloning plasmid for the PFKM gene.

PFN1 cloning plasmid

CSB-CL017824HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggccgggtggaacgcctacatcgacaacctcatggcggacgggacctgtcaggacgcggccatcgtgggctacaaggactcgccctccgtctgggccgccgtccccgggaaaacgttcgtcaacatcacgccagctgaggtgggtgtcctggttggcaaagaccggtcaagttt
  • Show more
Description: A cloning plasmid for the PFN1 gene.

PFN2 cloning plasmid

CSB-CL017825HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atggccggttggcagagctacgtggataacctgatgtgcgatggctgctgccaggaggccgccattgtcggctactgcgacgccaaatacgtctgggcagccacggcagggggcgtctttcagagcattacgccaatagaaatagatatgattgtaggaaaagaccgggaaggttt
  • Show more
Description: A cloning plasmid for the PFN2 gene.

PGAM2 cloning plasmid

CSB-CL017835HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atggccactcaccgcctcgtgatggtccggcacggcgagagcacatggaaccaggagaaccgtttctgtggctggttcgatgcagagctgagtgaaaaggggaccgaggaggccaagcggggagccaaggccatcaaggatgccaagatggagtttgacatctgctacacgtcagt
  • Show more
Description: A cloning plasmid for the PGAM2 gene.

PGC cloning plasmid

CSB-CL017849HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgaagtggatggtggtggtcttggtctgcctccagctcttggaggcagcagtggtcaaagtgcccctgaagaaatttaagtctatccgtgagaccatgaaggagaagggcttgctgggggagttcctgaggacccacaagtatgatcctgcttggaagtaccgctttggtgacct
  • Show more
Description: A cloning plasmid for the PGC gene.

PGD cloning plasmid

CSB-CL017850HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1452
  • Sequence: atggcccaagctgacatcgcgctgatcggattggccgtcatgggccagaacttaattctgaacatgaatgaccacggctttgtggtctgtgcttttaataggactgtctccaaagttgatgatttcttggccaatgaggcaaagggaaccaaagtggtgggtgcccagtccctga
  • Show more
Description: A cloning plasmid for the PGD gene.

PGF cloning plasmid

CSB-CL017854HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atgccggtcatgaggctgttcccttgcttcctgcagctcctggccgggctggcgctgcctgctgtgcccccccagcagtgggccttgtctgctgggaacggctcgtcagaggtggaagtggtacccttccaggaagtgtggggccgcagctactgccgggcgctggagaggctggt
  • Show more
Description: A cloning plasmid for the PGF gene.

PGK1 cloning plasmid

CSB-CL017856HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtcgctttctaacaagctgacgctggacaagctggacgttaaagggaagcgggtcgttatgagagtcgacttcaatgttcctatgaagaacaaccagataacaaacaaccagaggattaaggctgctgtcccaagcatcaaattctgcttggacaatggagccaagtcggtag
  • Show more
Description: A cloning plasmid for the PGK1 gene.

PGK2 cloning plasmid

CSB-CL017859HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atgtctctttctaagaagttgactttagacaaactggatgttagagggaagcgagtcatcatgagagtagacttcaatgttcccatgaagaagaaccagattacaaacaaccagaggatcaaggcttccatcccaagcatcaagtactgcctggacaatggagccaaggcagtag
  • Show more
Description: A cloning plasmid for the PGK2 gene.

PGLS cloning plasmid

CSB-CL017861HU1-10ug 10ug
EUR 279
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 603
  • Sequence: atggccgcgccggccccgggcctcatctcggtgttctcgagttcccaggagctgggtgcggcgctagcgcagctggtggcccagcgcgcagcatgctgcctggcaggggcccgcgcccgtttcgcgctcggcctgtcgggcgggagcctcgtctcgatgctagcccgcgagctacc
  • Show more
Description: A cloning plasmid for the PGLS gene.

PGLS cloning plasmid

CSB-CL017861HU2-10ug 10ug
EUR 327
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 777
  • Sequence: atggccgcgccggccccgggcctcatctcggtgttctcgagttcccaggagctgggtgcggcgctagcgcagctggtggcccagcgcgcagcatgctgcctggcaggggcccgcgcccgtttcgcgctcggcttgtcgggcgggagcctcgtctcgatgctagcccgcgagctacc
  • Show more
Description: A cloning plasmid for the PGLS gene.

PGLYRP3 cloning plasmid

CSB-CL017864HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atggggacgctgccatggcttcttgccttcttcattctgggtctccaggcttgggatactcccaccatcgtctcccgcaaggagtggggggcaagaccgctcgcctgcagggccctgctgaccctgcctgtggcctacatcatcacagaccagctcccagggatgcagtgccagc
  • Show more
Description: A cloning plasmid for the PGLYRP3 gene.

PGLYRP3 cloning plasmid

CSB-CL017864HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1026
  • Sequence: atggggacgctgccatggcttcttgccttcttcattctgggtctccaggcttgggatactcccaccatcgtctcccgcaaggagtggggggcaagaccgctcgcctgcagggccctgctgaccctgcctgtggcctacatcatcacagaccagctcccagggatgcagtgccagc
  • Show more
Description: A cloning plasmid for the PGLYRP3 gene.

PGLYRP4 cloning plasmid

CSB-CL017865HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: ATGCTGCCGTGGCTTCTTGTCTTCTCTGCTCTGGGTCTCCAGGCCTGGGGTGATTCCTCCTGGAACAAAACACAAGCTAAACAGGTATCAGAGGGGCTCCAGTACCTATTTGAGAACATCTCCCAGCTCACTGAAAAAGGCCTTCCCACAGATGTCTCCACCACGGTCTCTCGCA
  • Show more
Description: A cloning plasmid for the PGLYRP4 gene.

PGM1 cloning plasmid

CSB-CL017866HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: atggtgaagatcgtgacagttaagacccaggcgtaccaggaccagaagccgggcacgagcgggctgcggaagcgggtgaaggtgttccagagcagcgccaactacgcggagaacttcatccagagtatcatctccaccgtggagccggcgcagcggcaggaggccacgctggtgg
  • Show more
Description: A cloning plasmid for the PGM1 gene.

PGM1 cloning plasmid

CSB-CL017866HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1689
  • Sequence: ATGGTGAAGATCGTGACAGTTAAGACCCAGGCGTACCAGGACCAGAAGCCGGGCACGAGCGGGCTGCGGAAGCGGGTGAAGGTGTTCCAGAGCAGCGCCAACTACGCGGAGAACTTCATCCAGAGTATCATCTCCACCGTGGAGCCGGCGCAGCGGCAGGAGGCCACGCTGGTGG
  • Show more
Description: A cloning plasmid for the PGM1 gene.

PGM3 cloning plasmid

CSB-CL017869HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggatttaggtgctattacaaaatactcagcattacacgccaagcccaatggactgatccttcaatacgggactgctggatttcgaacgaaggcagaacatcttgatcatgtcatgtttcgcatgggattattagctgtcctgaggtcaaaacagacaaaatccactataggag
  • Show more
Description: A cloning plasmid for the PGM3 gene.

PGRMC1 cloning plasmid

CSB-CL017876HU-10ug 10ug
EUR 275
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggctgccgaggatgtggtggcgactggcgccgacccaagcgatctggagagcggcgggctgctgcatgagattttcacgtcgccgctcaacctgctgctgcttggcctctgcatcttcctgctctacaagatcgtgcgcggggaccagccggcggccagcggcgacagcgacga
  • Show more
Description: A cloning plasmid for the PGRMC1 gene.

PGRMC2 cloning plasmid

CSB-CL017877HU-10ug 10ug
EUR 297
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 672
  • Sequence: atggcggctggtgatggggacgtgaagctaggcaccctggggagtggcagcgagagcagcaacgacggcggcagcgagagtccaggcgacgcgggagcggcagcggaagggggaggctgggcggcggcggcgttggcgcttctgacggggggcggggaaatgctgctgaacgtggc
  • Show more
Description: A cloning plasmid for the PGRMC2 gene.

PHACTR3 cloning plasmid

CSB-CL017882HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1680
  • Sequence: atggccgcgtcggaggacgggagcggctgcctcgtgtcgcggggccgctcgcagagtgaccccagcgtcctcaccgactcctcggccacctcctccgcggacgccggggagaacccagatgagatggaccaaacgcccccggcgcgtcctgaatatctggtctcagggattcgaa
  • Show more
Description: A cloning plasmid for the PHACTR3 gene.

PHACTR4 cloning plasmid

CSB-CL017883HU1-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2109
  • Sequence: atggaagatccatttgaggaagcagaccagcccactacagagccaggcatggtcctggacagtgtggaagcaggagacacaacacctcctaccaaaaggaagagcaagttctcaggctttggcaagatcttcaagccctggaaatggaggaaaaaaaaaagtagtgataaattta
  • Show more
Description: A cloning plasmid for the PHACTR4 gene.

PHACTR4 cloning plasmid

CSB-CL017883HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggtcctggacagtgtggaagcaggagacacaacacctcctaccaaaaggaagagcaagttctcaggctttggcaagatcttcaagccctggaaatggaggaaaaaaaaaagtagtgataaatttaaagagacttcagaagttttagaacggaaaatatctatgcgaaagccaa
  • Show more
Description: A cloning plasmid for the PHACTR4 gene.

PHB cloning plasmid

CSB-CL017885HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: atggctgccaaagtgtttgagtccattggcaagtttggcctggccttagctgttgcaggaggcgtggtgaactctgccttatataatgtggatgctgggcacagagctgtcatctttgaccgattccgtggagtgcaggacattgtggtaggggaagggactcattttctcatccc
  • Show more
Description: A cloning plasmid for the PHB gene.

PHC1 cloning plasmid

CSB-CL017891HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgccaggtacagtgcagtctggtcaggcccatttggcctcctcgccaccttcatcccaggctcctggtgcactgcaggagtgccctcccacattggcccctgggatgacccttgctcctgtgcaggggacagcacatgtggtaaagggtggggctaccacctcctcacctgttg
  • Show more
Description: A cloning plasmid for the PHC1 gene.

PHF1 cloning plasmid

CSB-CL017897HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atggcgcagcccccccggctgagccgctctggtgcctcctcactttgggacccagcttctcctgctcccacctctggccccaggcctcggctttgggagggtcaagatgtgctggccagatggactgatgggctgctatacttgggtaccatcaaaaaggtggacagtgctaggg
  • Show more
Description: A cloning plasmid for the PHF1 gene.

PHF10 cloning plasmid

CSB-CL017898HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1227
  • Sequence: atgcttcaagaacaagtcagtgaatatttgggtgtgacctcctttaaaaggaaatatccagagcgacgagatttgtctcacaaggagaaactctacctgagagagctaaatgtcattactgaaactcagtgcactctaggcttaacagcattgcgcagtgatgaagtgattgatt
  • Show more
Description: A cloning plasmid for the PHF10 gene.

PHF11 cloning plasmid

CSB-CL017900HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atggaaaaaaggacatgtgcactctgccccaaagatgtcgaatataatgtcctgtactttgcacaatcagagaatatagctgctcatgagaattgtttgctgtattcttcaggacttgtggaatgtgaggatcaggatccacttaatcctgatagaagttttgatgtggaatcagt
  • Show more
Description: A cloning plasmid for the PHF11 gene.

PHF12 cloning plasmid

CSB-CL017901HU-10ug 10ug
EUR 702
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2115
  • Sequence: ATGTGGGAGAAAATGGAGACCAAGACGATCGTGTACGACTTGGACACATCAGGGGGGCTGATGGAGCAAATCCAAGCTCTGCTGGCTCCCCCCAAGACGGACGAGGCAGAAAAGCGCAGTCGGAAGCCTGAGAAGGAGCCCCGGAGAAGCGGCAGGGCCACCAACCACGACAGCT
  • Show more
Description: A cloning plasmid for the PHF12 gene.

PHF13 cloning plasmid

CSB-CL017902HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 903
  • Sequence: atggactctgactcttgcgccgccgccttccacccggaggaatactcccccagttgcgagaggcgcaggaccgtggaagacttcaacaaattctgcacctttgtcttggcctatgctggctacatcccttatccgaaggaggaactccctttaaggagcagccccagccctgctaa
  • Show more
Description: A cloning plasmid for the PHF13 gene.

PHF19 cloning plasmid

CSB-CL017907HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggagaatcgagctctggatccagggactcgggactcctatggtgccaccagccacctccccaacaagggggccctggcgaaggtcaagaacaacttcaaagacttgatgtccaaactgacggagggccagtatgtgctgtgccggtggacagatggcctgtactacctcgggaa
  • Show more
Description: A cloning plasmid for the PHF19 gene.

PHF19 cloning plasmid

CSB-CL017907HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1743
  • Sequence: ATGGAGAATCGAGCTCTGGATCCAGGGACTCGGGACTCCTATGGTGCCACCAGCCACCTCCCCAACAAGGGGGCCCTGGCGAAGGTCAAGAACAACTTCAAAGACTTGATGTCCAAACTGACGGAGGGCCAGTATGTGCTGTGCCGGTGGACAGATGGCCTGTACTACCTCGGGA
  • Show more
Description: A cloning plasmid for the PHF19 gene.

PHF20L1 cloning plasmid

CSB-CL017910HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgagtaaaaagcccccaaatcgccctggaatcacttttgagattggtgctcgtttggaggcactggactacttacaaaaatggtatccatcacgaattgaaaaaattgactatgaggagggcaagatgttggtccattttgagcgctggagtcatcgttatgatgagtggattta
  • Show more
Description: A cloning plasmid for the PHF20L1 gene.

PHF20L1 cloning plasmid

CSB-CL017910HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atgatccagtgtgaagagtgcttgtgttggcaacacagcgtgtgcatggggctgctggaggagagcattccagagcagtacatctgctatatctgccgggacccaccaggtcagaggtggagtgcaaaatatcgttatgataaggagtggttgaataatgggagaatgtgcgggtt
  • Show more
Description: A cloning plasmid for the PHF20L1 gene.

PHF21A cloning plasmid

CSB-CL017911HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2043
  • Sequence: atggagttgcagactctacaggaggctcttaaagtggaaattcaggttcaccagaaactggttgctcaaatgaagcaggatccacagaatgctgacttaaagaaacagcttcatgaactccaagccaaaatcacagctttgagtgagaaacagaaaagagtagttgaacagctac
  • Show more
Description: A cloning plasmid for the PHF21A gene.

PHF21B cloning plasmid

CSB-CL017912HU-10ug 10ug
EUR 556
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1596
  • Sequence: atggagctgcagagccggcccgaggcgctcgccgtggaactcgcgcgccaccagaacggcgacctcaagaagcagctccacgaaaggcagccgcggatcgccgcgctcagcgacaaacaagctttgggaacgatcactgcagtgcctgtcacgggtcctcaggtcagctccttgc
  • Show more
Description: A cloning plasmid for the PHF21B gene.

PHF23 cloning plasmid

CSB-CL017913HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1212
  • Sequence: atgctggaagccatggcggagcccagtcccgaagatccacctccgacccttaagccagagactcagccaccagagaaacggcggagaacaattgaggatttcaacaaattctgcagttttgttttggcatatgctggttacattccccctagcaaagaggaaagtgactggccag
  • Show more
Description: A cloning plasmid for the PHF23 gene.
On this setup, the goal gene is tagged with an artificial motif dictating protein degradation. When the system options had been characterised utilizing the monomeric superfolder GFP as a mannequin protein, the basal ranges of fluorescence had been introduced right down to zero (i.e. under the restrict of detection). In all, these novel expression techniques represent another device to altogether suppress leaky gene expression, and they are often simply tailored to different vector codecs and plugged-in into totally different Gram-negative bacterial species on the person’s will.

Leave a Reply

Your email address will not be published. Required fields are marked *