Sars2 Antibody Test

Lab Reagents

Human IgG antibody Laboratories manufactures the sars2 antibody test reagents distributed by Genprice. The Sars2 Antibody Test reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Antibody. Other Sars2 products are available in stock. Specificity: Sars2 Category: Antibody Group: Test

Test information

anti-SARS2

YF-PA19459 100 ul
EUR 403
Description: Rabbit polyclonal to SARS2

anti-SARS2

YF-PA19460 100 ug
EUR 403
Description: Rabbit polyclonal to SARS2

SARS2 Polyclonal Conjugated Antibody

C27672 100ul
EUR 397

SARS2 Rabbit pAb

A12297-100ul 100 ul
EUR 308

SARS2 Rabbit pAb

A12297-200ul 200 ul
EUR 459

SARS2 Rabbit pAb

A12297-20ul 20 ul
EUR 183

SARS2 Rabbit pAb

A12297-50ul 50 ul
EUR 223

SARS2 cloning plasmid

CSB-CL878836HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: atggctgcgtccatggcgcggcgcttgtggcctttgctgactcgtcgggggttccggccccggggaggctgcatctccaacgatagtccaaggagaagtttcactacagagaaacgaaaccggaacctcctgtacgagtatgcgcgcgagggctacagcgcactccctcagctgg
  • Show more
Description: A cloning plasmid for the SARS2 gene.

SARS2 ELISA KIT|Human

EF002720 96 Tests
EUR 689

Mouse SARS2 shRNA Plasmid

20-abx977615
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SARS2 shRNA Plasmid

20-abx960340
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SARS2 Recombinant Protein (Human)

RP027610 100 ug Ask for price

SARS2 Recombinant Protein (Rat)

RP227483 100 ug Ask for price

SARS2 Recombinant Protein (Mouse)

RP170015 100 ug Ask for price

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-20tests 20 tests
EUR 236
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Accu-Tell COVID-19 IgG/IgM Rapid Test

GEN-B352-40tests 40 tests
EUR 321
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

Seryl-tRNA Synthetase 2, Mitochondrial (SARS2) Antibody

20-abx003637
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.