Sars Pvr Test

Lab Reagents

Human IgG antibody Laboratories manufactures the sars pvr test reagents distributed by Genprice. The Sars Pvr Test reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Test. Other Sars products are available in stock. Specificity: Sars Category: Pvr Group: Test

Test information

PVR Antibody

1-CSB-PA297000
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PVR. Recognizes PVR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PVR Antibody

1-CSB-PA019093ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PVR. Recognizes PVR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PVR Antibody

1-CSB-PA019093ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PVR. Recognizes PVR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PVR siRNA

20-abx930486
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Sars/ Rat Sars ELISA Kit

ELI-41050r 96 Tests
EUR 886

PVR Rabbit pAb

A11824-100ul 100 ul
EUR 308

PVR Rabbit pAb

A11824-200ul 200 ul
EUR 459

PVR Rabbit pAb

A11824-20ul 20 ul Ask for price

PVR Rabbit pAb

A11824-50ul 50 ul Ask for price

PVR Conjugated Antibody

C33018 100ul
EUR 397

PVR cloning plasmid

CSB-CL019093HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atggcccgagccatggccgccgcgtggccgctgctgctggtggcgctactggtgctgtcctggccacccccaggaaccggggacgtcgtcgtgcaggcgcccacccaggtgcccggcttcttgggcgactccgtgacgctgccctgctacctacaggtgcccaacatggaggtga
  • Show more
Description: A cloning plasmid for the PVR gene.

PVR Rabbit pAb

A5753-100ul 100 ul
EUR 308

PVR Rabbit pAb

A5753-200ul 200 ul
EUR 459

PVR Rabbit pAb

A5753-20ul 20 ul
EUR 183

PVR Rabbit pAb

A5753-50ul 50 ul
EUR 223

Anti-PVR antibody

STJ28320 100 µl
EUR 277
Description: The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-PVR antibody

STJ113403 100 µl
EUR 277
Description: The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene.